ID: 1160445630

View in Genome Browser
Species Human (GRCh38)
Location 18:78925069-78925091
Sequence CTTTTCATGCCCCTCACTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 160}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160445620_1160445630 21 Left 1160445620 18:78925025-78925047 CCCTGGACGCCGTTTGCTCCAAG No data
Right 1160445630 18:78925069-78925091 CTTTTCATGCCCCTCACTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 160
1160445621_1160445630 20 Left 1160445621 18:78925026-78925048 CCTGGACGCCGTTTGCTCCAAGG No data
Right 1160445630 18:78925069-78925091 CTTTTCATGCCCCTCACTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 160
1160445625_1160445630 12 Left 1160445625 18:78925034-78925056 CCGTTTGCTCCAAGGAGGGAGAA No data
Right 1160445630 18:78925069-78925091 CTTTTCATGCCCCTCACTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 160
1160445626_1160445630 3 Left 1160445626 18:78925043-78925065 CCAAGGAGGGAGAATTTTCACGT No data
Right 1160445630 18:78925069-78925091 CTTTTCATGCCCCTCACTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 160
1160445619_1160445630 27 Left 1160445619 18:78925019-78925041 CCGGGGCCCTGGACGCCGTTTGC No data
Right 1160445630 18:78925069-78925091 CTTTTCATGCCCCTCACTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160445630 Original CRISPR CTTTTCATGCCCCTCACTGG TGG Intergenic
901132572 1:6971440-6971462 GTTTGCAAGCCCCTCAGTGGGGG + Intronic
901635121 1:10666966-10666988 CTCTCCATGGCCCTCACGGGAGG + Intronic
902142901 1:14371266-14371288 CTTTTCATGCCTCTTATGGGGGG + Intergenic
902418142 1:16254952-16254974 CTTTTCATGCCCTTTACATGTGG + Intronic
902513806 1:16979618-16979640 CTTTTCATCCCCCTCCCATGAGG - Intronic
902656872 1:17875109-17875131 CTTTTCTGGCCCATCCCTGGAGG - Intergenic
902983123 1:20139572-20139594 CTGTCCCTGCCCCTCCCTGGAGG - Intronic
904328534 1:29743327-29743349 CACCTCATCCCCCTCACTGGTGG + Intergenic
905357436 1:37394675-37394697 CTCTTCATGCTCCTTGCTGGGGG - Intergenic
908669341 1:66529497-66529519 CTTTTCAAACCAGTCACTGGGGG - Intergenic
910780313 1:90925187-90925209 ACTCTCATGCCCCCCACTGGGGG + Intronic
912308068 1:108591657-108591679 TCTTTCCTGCCCCTCCCTGGGGG + Intronic
915744695 1:158146879-158146901 CTTTTGGGGCCCCTCACTTGTGG - Intergenic
918200271 1:182259785-182259807 CTTTTCATGCCCTTCACATCTGG - Intergenic
918370163 1:183852912-183852934 CATTTCATGGCTCTCACTGAAGG - Intronic
918793586 1:188862383-188862405 CTTTTCATGCTCCTTAATGCAGG + Intergenic
1064687540 10:17879284-17879306 GTTTTCCTGCCACTCTCTGGAGG + Intronic
1067410023 10:46055966-46055988 CTTTTCATCCCACCCACCGGCGG - Intergenic
1068037687 10:51781703-51781725 CTTTTCCTGCCCCTCTCCAGTGG - Intronic
1073423636 10:103443158-103443180 CTTCTCCTGCTCCTCTCTGGAGG - Exonic
1074536641 10:114332666-114332688 CTTGCCAGGCCCCTCCCTGGAGG + Intronic
1075937086 10:126351659-126351681 GTTTTCATGCAGGTCACTGGAGG - Intronic
1077232463 11:1464040-1464062 CTTCTCAGGCCCATGACTGGAGG + Intergenic
1079122410 11:17695542-17695564 CTCTCCATGCCTCTCACTTGCGG - Intergenic
1079954194 11:26842425-26842447 GTTTTCATGCCCATCACTCATGG + Intergenic
1081604982 11:44521514-44521536 CTTTTGATCCTTCTCACTGGGGG + Intergenic
1085701233 11:78747635-78747657 CCTGTCAAGCCCCTCACTGTGGG + Intronic
1086343768 11:85874511-85874533 CTTTCCTTGCTCCTCACTGCTGG - Intronic
1090767520 11:129889438-129889460 CTTTTCCTGCCACTCAGTTGAGG - Intronic
1092912926 12:13164271-13164293 CTGTCCATGCCCCTCTCTGAGGG + Intergenic
1095738390 12:45582732-45582754 ATTATCATGGCCCTGACTGGAGG + Intergenic
1096749265 12:53748317-53748339 CTTTTCCTGCCCCGCAGTGTTGG - Intergenic
1101734263 12:107451406-107451428 CATTACATGCACCTCTCTGGAGG - Intronic
1102198444 12:111041044-111041066 CTCTTCATGCTTCTCTCTGGAGG - Intronic
1103326813 12:120127037-120127059 CTTTGCATTCTCCACACTGGGGG + Intergenic
1105845055 13:24286808-24286830 CTCGTCCTGCTCCTCACTGGGGG - Exonic
1106375411 13:29182056-29182078 CCTTGGATGCCCCTCCCTGGTGG + Intronic
1107613873 13:42144355-42144377 ATTTTCGTGCACATCACTGGGGG - Intronic
1107718747 13:43226660-43226682 CTTCTCCTGCCCATCACTTGTGG - Intronic
1108473632 13:50791330-50791352 CGCTTCATGCCCCTGACAGGAGG + Intronic
1111594939 13:90399512-90399534 CTTGTCAGGCCCCTCACAGAAGG - Intergenic
1112162294 13:96880716-96880738 CTTTTCATGCCTCAGATTGGTGG - Intergenic
1113335900 13:109375579-109375601 CTTTTCATTACCCACACTGTTGG - Intergenic
1113431791 13:110256721-110256743 CTATTCATGCCCCAGACCGGCGG + Intronic
1113437219 13:110302503-110302525 CTTCCCATGCCCCTCAGTGTGGG - Intronic
1115383355 14:32766011-32766033 CGCTTTTTGCCCCTCACTGGAGG + Intronic
1115986024 14:39104023-39104045 AATTTCATTCCCCTCACTGAAGG - Intronic
1118839256 14:69498962-69498984 GTTTTCAAGCCCCTCACAAGAGG + Intronic
1119666917 14:76491448-76491470 CTTCTCAAGCCTCTCCCTGGGGG + Exonic
1122480154 14:102041920-102041942 CTTCTCAGGCCCCTCACTCGGGG + Intronic
1123500297 15:20875963-20875985 CAGTTCCTGCCCCTGACTGGGGG + Intergenic
1123557543 15:21449656-21449678 CAGTTCCTGCCCCTGACTGGGGG + Intergenic
1123593770 15:21886937-21886959 CAGTTCCTGCCCCTGACTGGGGG + Intergenic
1125442919 15:39722567-39722589 CTTCTCCTGCCCCTCACTTATGG + Intronic
1130215289 15:81962799-81962821 CAGGTCCTGCCCCTCACTGGTGG - Intergenic
1130351403 15:83095020-83095042 TTTTTCATTCCCCTCACTAATGG - Intergenic
1131676588 15:94676249-94676271 CTTTTAATAGCCCTCAGTGGTGG + Intergenic
1202965893 15_KI270727v1_random:176828-176850 CAGTTCCTGCCCCTGACTGGGGG + Intergenic
1132692963 16:1189834-1189856 CTGTTCAGGCCTCTCTCTGGGGG + Intronic
1135645157 16:24155248-24155270 CTTTGCATGGGCCTCATTGGAGG + Intronic
1136490441 16:30604518-30604540 CTTTGCCTACCCCTCACTGCTGG - Exonic
1140888023 16:79261570-79261592 CTTCTCATGCCCTTCTCTGGGGG + Intergenic
1141066051 16:80914962-80914984 GGTCTCATGCCCGTCACTGGAGG + Intergenic
1141198408 16:81878800-81878822 CTTATCTTGCCTCTCACTGTTGG + Intronic
1141686025 16:85570459-85570481 CTTTTCATGACTCTCTCTGCAGG - Intergenic
1141957801 16:87383965-87383987 TTTCTCATGCCCGTCACGGGCGG - Intronic
1142643468 17:1298180-1298202 CTCTTCAAGTCCCTGACTGGAGG - Intronic
1142917480 17:3153834-3153856 TCTGTCAAGCCCCTCACTGGAGG + Intergenic
1147375465 17:40020136-40020158 CTCTCCATGCCCCTCATTGTTGG - Intronic
1149001170 17:51759118-51759140 CTTGTCAAGCCCCTCATTGTTGG + Intronic
1150163752 17:62921705-62921727 ATTCTCAAGCACCTCACTGGTGG - Intergenic
1153508168 18:5824656-5824678 GTTTTGATGCCTCTCACTGAGGG - Intergenic
1156282356 18:35652351-35652373 CTTTTCATGCCTCTCTCAGAGGG + Intronic
1158522639 18:58184377-58184399 GTTTTGATGAGCCTCACTGGAGG + Intronic
1159616810 18:70590825-70590847 CTTTTCATGACCCTCTGTGTTGG + Intergenic
1160445630 18:78925069-78925091 CTTTTCATGCCCCTCACTGGTGG + Intergenic
1165065194 19:33224654-33224676 CTTCTCCTGTCCCTCCCTGGAGG + Intronic
1165112054 19:33508201-33508223 CTCCTCATGGCCCTCACTGCTGG - Intronic
926155758 2:10453172-10453194 TGTTTCAAGCCCTTCACTGGTGG + Intergenic
927379522 2:22462711-22462733 CTTTTCATACCCCACTCTGTGGG + Intergenic
931156396 2:59636085-59636107 GTTTTCATGCCCATCAATAGTGG + Intergenic
937311325 2:120905165-120905187 CTTTTACAGCCCCTCACTGCAGG - Intronic
939138893 2:138329706-138329728 CTTCTCATGCTCCTGACTGCTGG - Intergenic
941874444 2:170418736-170418758 CTTTTCCTCCCCCAAACTGGGGG + Intronic
941925881 2:170894259-170894281 AAATTCATGCACCTCACTGGAGG - Intergenic
942045722 2:172098150-172098172 GGTTTCATACCCCTCTCTGGGGG + Intergenic
942692132 2:178596859-178596881 TTTTTCATGGCTCTCACTGGAGG - Intronic
942740492 2:179171057-179171079 CATTTCTAGCCCCTGACTGGTGG - Intronic
944853512 2:203744072-203744094 CTCTTCATTCCCTTCACTAGGGG - Intergenic
946196196 2:218034150-218034172 CTTATCAGGCCCCACAGTGGGGG - Intergenic
948090606 2:235291410-235291432 CTTTTCATCCCATTCTCTGGAGG - Intergenic
948797437 2:240412156-240412178 CTCTGCAGGCCCCTCCCTGGAGG - Intergenic
1169127342 20:3139233-3139255 TTTTGCATACCTCTCACTGGTGG - Intronic
1169157306 20:3342549-3342571 CTTTACATGGCGCTCACTGAGGG - Intronic
1170209742 20:13836761-13836783 CTGTTCCTGCCTGTCACTGGTGG + Intergenic
1170735238 20:19008590-19008612 CTTTTCATGCCCCTCATCGAGGG - Intergenic
1171322364 20:24257716-24257738 CTTTTCATGTCCCTCTATGGAGG - Intergenic
1173868070 20:46325415-46325437 CATTTCATGCCCCTGTCTAGAGG + Intergenic
1174340531 20:49892422-49892444 CTTCACATGCTCCTCACTGAGGG - Intergenic
1175283056 20:57818226-57818248 GATTTCATGCTCCTCTCTGGAGG + Intergenic
1178314626 21:31558313-31558335 CTTTTAATGCCCCCCTCCGGGGG + Intronic
1178836382 21:36100983-36101005 CTGTTCTTGCCCATCCCTGGGGG - Intergenic
1181767605 22:25103059-25103081 CTTTTCCTGACCCTCACAAGAGG + Intronic
1184800726 22:46757493-46757515 CTTTTCACGCCCCTCAGCTGTGG + Intergenic
953187993 3:40656000-40656022 CTTGACATGCCCCTCTCTGTGGG + Intergenic
955018044 3:55090746-55090768 CTTTTATCACCCCTCACTGGAGG + Intergenic
955125375 3:56105757-56105779 CTGTTCATCCTCCTCACTGAGGG - Intronic
955435906 3:58899012-58899034 TGTTTCATGGCCTTCACTGGTGG - Intronic
955469130 3:59267998-59268020 TTTTTCCTGCCCCAAACTGGTGG - Intergenic
956168742 3:66416200-66416222 CTTTTGAGGGCCCACACTGGAGG + Intronic
956473615 3:69595493-69595515 CCTTTCATGGCCCTCACTTCTGG + Intergenic
960040893 3:113148929-113148951 CTTCTCTTGCCCCTCCCTGTAGG + Intergenic
960297887 3:115966901-115966923 CTGTTTATGCCCCTCCCTGGTGG + Intronic
962147410 3:132855205-132855227 CTATTCCTGCCCCTACCTGGAGG - Intergenic
963724636 3:148906239-148906261 CGTTTCATGCCCCTGATTTGAGG + Intergenic
968967550 4:3776772-3776794 CTTGAGATGCCCCTCAGTGGTGG - Intergenic
969145670 4:5121883-5121905 CTTTTCTGGCCCCTCACTTGTGG - Intronic
969348153 4:6581976-6581998 GCTTTCATGCCCCTCCCTGAGGG + Intronic
974302719 4:60089698-60089720 CTTTCCAGGCCCCTCACTGAAGG + Intergenic
976130849 4:81882446-81882468 CCCTTCTTGCTCCTCACTGGTGG + Intronic
977142881 4:93397401-93397423 GTTTTCATGCTAATCACTGGAGG - Intronic
982578920 4:157153565-157153587 CTTCTCCTGCCACTCACTGCTGG - Intronic
987371865 5:17200948-17200970 CATTTGTTGCCCCTCCCTGGTGG - Intronic
988226489 5:28418751-28418773 ATTTTCATGTCCCTCAATGCTGG + Intergenic
990680138 5:58233455-58233477 CTATTCATGCACCTCACTATGGG - Intergenic
991462712 5:66876454-66876476 CTTGTCATGGCCCTCTGTGGTGG + Intronic
992999525 5:82366521-82366543 CCTTTCTTGCCCCTTACTGCAGG - Intronic
993013455 5:82509873-82509895 CTTTTCATGCCCCTCAGGCTTGG - Intergenic
993825241 5:92676398-92676420 CTTTTCATTCCCCTCACCATAGG - Intergenic
995275657 5:110274892-110274914 CTTTTCATGCCCCTGTCTTCTGG + Intergenic
996159330 5:120143903-120143925 GTTCTGATGCACCTCACTGGGGG - Intergenic
998361128 5:141588417-141588439 CTCTTCCTGCCCCTTACTTGAGG - Intronic
1000252636 5:159510208-159510230 CTCTTCAGACCCCTCACTGAGGG - Intergenic
1003452420 6:6247647-6247669 CTTTTCATGCCGCTCTCTGCAGG - Intronic
1004483037 6:16039128-16039150 CATATGATGCCCCTCACTGCTGG + Intergenic
1004825051 6:19410722-19410744 TTTTTCATTCCACTCACTGTAGG - Intergenic
1006719898 6:36143267-36143289 CTTGTGCTGCCCCTCACTGGGGG - Intronic
1007609972 6:43142954-43142976 CTTTTAATGGCCCACACTGAGGG - Intronic
1007958012 6:45934582-45934604 CTTTTCAGACCTCTCACTAGGGG + Intronic
1008299962 6:49824511-49824533 CTTTTTATGACTATCACTGGTGG - Intergenic
1011448501 6:87468637-87468659 CTTTTCCTGCCAGTCACTGATGG - Intronic
1012491151 6:99783749-99783771 CTAATCAGGCCCCTCAGTGGAGG + Intergenic
1013349708 6:109294177-109294199 CTTTTCATGCCACTCCCAGGTGG - Intergenic
1013750005 6:113394394-113394416 CTTTACATGGACCTCACTGTGGG - Intergenic
1013774213 6:113661234-113661256 CCTTTCATGCCCACCACTGTGGG + Intergenic
1014699179 6:124662177-124662199 CTCTTCATTCCCCTCACCTGTGG - Intronic
1015230750 6:130912439-130912461 CTGTTCATGGCCCGCACTCGGGG + Intronic
1017714723 6:157200958-157200980 CTGCTGAGGCCCCTCACTGGAGG - Exonic
1019595064 7:1854617-1854639 CTCCTCATGCCCCTCACAGTGGG + Intronic
1025263459 7:57438101-57438123 CTTGTCATGCCGGGCACTGGGGG - Intergenic
1025740586 7:64192693-64192715 CTTGTCGTGCCCAGCACTGGGGG - Intronic
1027471394 7:78578779-78578801 CTGTTCATGACTCTCAGTGGAGG + Intronic
1027500693 7:78946610-78946632 CTTTTCATGCACCTTAGAGGTGG + Intronic
1030130804 7:106197962-106197984 CATTTAATCCCCTTCACTGGAGG + Intergenic
1034721849 7:153300615-153300637 CTTTTCTTGCCCCTTAATGATGG - Intergenic
1037114865 8:15212323-15212345 CTTTTGAAGCCACACACTGGTGG + Intronic
1039105380 8:33983987-33984009 CTTTCCCTTCCCCTCACTGATGG - Intergenic
1043467000 8:80519212-80519234 CTTTTTATGCACCTAATTGGAGG - Exonic
1043977421 8:86598981-86599003 CTTTACATACCCCTCAGTAGGGG + Intronic
1045568705 8:103347863-103347885 CTATACATGCCCCACTCTGGTGG - Intergenic
1045722317 8:105127959-105127981 CCTTTAATGCCCCTGACTAGGGG + Intronic
1047377523 8:124316041-124316063 CTTTCCTTGCCCCTCACTTTAGG + Intronic
1055118870 9:72635321-72635343 ATATACATGCCCCTCCCTGGAGG + Intronic
1056249839 9:84736420-84736442 CTTAGAATGCCCCACACTGGTGG + Intronic
1057955981 9:99408358-99408380 CTTTTCATGCTCCTCACACAGGG - Intergenic
1059639584 9:116203702-116203724 CTTATGATGCCCCTGACAGGTGG + Intronic
1061665538 9:132159096-132159118 CTAATCATCCCCTTCACTGGTGG - Intergenic
1186453085 X:9689503-9689525 CTTTTCCTGCCCCACAATTGTGG - Intronic
1188698644 X:33231382-33231404 CTTTTCATGACTCTATCTGGTGG - Intronic
1189907156 X:45773286-45773308 CTCTTCATGCCTCTGACTAGGGG - Intergenic
1190774347 X:53540718-53540740 CTTTTCCTGATACTCACTGGGGG + Intronic
1194652754 X:96535072-96535094 CTTTACAAGCCCATCCCTGGTGG + Intergenic