ID: 1160446085

View in Genome Browser
Species Human (GRCh38)
Location 18:78927856-78927878
Sequence GAGAGTATACAGAAGCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160446085_1160446090 5 Left 1160446085 18:78927856-78927878 CCCCCAGGCTTCTGTATACTCTC No data
Right 1160446090 18:78927884-78927906 GAATAAAAACTCTATTGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160446085 Original CRISPR GAGAGTATACAGAAGCCTGG GGG (reversed) Intergenic
No off target data available for this crispr