ID: 1160446461

View in Genome Browser
Species Human (GRCh38)
Location 18:78931516-78931538
Sequence TGTTATGTCAGATGAGCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160446461_1160446469 26 Left 1160446461 18:78931516-78931538 CCTTTAGCTCATCTGACATAACA No data
Right 1160446469 18:78931565-78931587 GGTTACCCCCATTTTGAAGTGGG No data
1160446461_1160446470 27 Left 1160446461 18:78931516-78931538 CCTTTAGCTCATCTGACATAACA No data
Right 1160446470 18:78931566-78931588 GTTACCCCCATTTTGAAGTGGGG No data
1160446461_1160446471 30 Left 1160446461 18:78931516-78931538 CCTTTAGCTCATCTGACATAACA No data
Right 1160446471 18:78931569-78931591 ACCCCCATTTTGAAGTGGGGAGG No data
1160446461_1160446468 25 Left 1160446461 18:78931516-78931538 CCTTTAGCTCATCTGACATAACA No data
Right 1160446468 18:78931564-78931586 TGGTTACCCCCATTTTGAAGTGG No data
1160446461_1160446463 -6 Left 1160446461 18:78931516-78931538 CCTTTAGCTCATCTGACATAACA No data
Right 1160446463 18:78931533-78931555 ATAACATCCTTTAGGATAGATGG No data
1160446461_1160446466 5 Left 1160446461 18:78931516-78931538 CCTTTAGCTCATCTGACATAACA No data
Right 1160446466 18:78931544-78931566 TAGGATAGATGGACCAGGCTTGG No data
1160446461_1160446464 0 Left 1160446461 18:78931516-78931538 CCTTTAGCTCATCTGACATAACA No data
Right 1160446464 18:78931539-78931561 TCCTTTAGGATAGATGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160446461 Original CRISPR TGTTATGTCAGATGAGCTAA AGG (reversed) Intergenic
No off target data available for this crispr