ID: 1160447525

View in Genome Browser
Species Human (GRCh38)
Location 18:78939210-78939232
Sequence GACCTAGCATTTGCCTCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160447525_1160447529 15 Left 1160447525 18:78939210-78939232 CCATTGGAGGCAAATGCTAGGTC No data
Right 1160447529 18:78939248-78939270 CTGCTGGAGTTTCATTTTCATGG No data
1160447525_1160447527 -1 Left 1160447525 18:78939210-78939232 CCATTGGAGGCAAATGCTAGGTC No data
Right 1160447527 18:78939232-78939254 CTGGAAACCAAAGTGTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160447525 Original CRISPR GACCTAGCATTTGCCTCCAA TGG (reversed) Intergenic
No off target data available for this crispr