ID: 1160448792

View in Genome Browser
Species Human (GRCh38)
Location 18:78947669-78947691
Sequence AAACCCTCTCGGCGTGATTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160448792_1160448795 6 Left 1160448792 18:78947669-78947691 CCGCAATCACGCCGAGAGGGTTT No data
Right 1160448795 18:78947698-78947720 TCAGAGGATTGTGCATTTTATGG No data
1160448792_1160448794 -10 Left 1160448792 18:78947669-78947691 CCGCAATCACGCCGAGAGGGTTT No data
Right 1160448794 18:78947682-78947704 GAGAGGGTTTCGTCAGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160448792 Original CRISPR AAACCCTCTCGGCGTGATTG CGG (reversed) Intergenic
No off target data available for this crispr