ID: 1160452079

View in Genome Browser
Species Human (GRCh38)
Location 18:78973243-78973265
Sequence TTCCTGGCCGTAGAGCTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160452079_1160452092 29 Left 1160452079 18:78973243-78973265 CCGGGGAGCTCTACGGCCAGGAA No data
Right 1160452092 18:78973295-78973317 CGCGCACACGGCCAGAGCACGGG No data
1160452079_1160452083 -9 Left 1160452079 18:78973243-78973265 CCGGGGAGCTCTACGGCCAGGAA No data
Right 1160452083 18:78973257-78973279 GGCCAGGAAAAGTGCGCAGGGGG No data
1160452079_1160452082 -10 Left 1160452079 18:78973243-78973265 CCGGGGAGCTCTACGGCCAGGAA No data
Right 1160452082 18:78973256-78973278 CGGCCAGGAAAAGTGCGCAGGGG No data
1160452079_1160452088 17 Left 1160452079 18:78973243-78973265 CCGGGGAGCTCTACGGCCAGGAA No data
Right 1160452088 18:78973283-78973305 CCCCGCGTCGGGCGCGCACACGG No data
1160452079_1160452085 5 Left 1160452079 18:78973243-78973265 CCGGGGAGCTCTACGGCCAGGAA No data
Right 1160452085 18:78973271-78973293 CGCAGGGGGCGTCCCCGCGTCGG No data
1160452079_1160452086 6 Left 1160452079 18:78973243-78973265 CCGGGGAGCTCTACGGCCAGGAA No data
Right 1160452086 18:78973272-78973294 GCAGGGGGCGTCCCCGCGTCGGG No data
1160452079_1160452091 28 Left 1160452079 18:78973243-78973265 CCGGGGAGCTCTACGGCCAGGAA No data
Right 1160452091 18:78973294-78973316 GCGCGCACACGGCCAGAGCACGG No data
1160452079_1160452093 30 Left 1160452079 18:78973243-78973265 CCGGGGAGCTCTACGGCCAGGAA No data
Right 1160452093 18:78973296-78973318 GCGCACACGGCCAGAGCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160452079 Original CRISPR TTCCTGGCCGTAGAGCTCCC CGG (reversed) Intergenic