ID: 1160452082

View in Genome Browser
Species Human (GRCh38)
Location 18:78973256-78973278
Sequence CGGCCAGGAAAAGTGCGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160452079_1160452082 -10 Left 1160452079 18:78973243-78973265 CCGGGGAGCTCTACGGCCAGGAA No data
Right 1160452082 18:78973256-78973278 CGGCCAGGAAAAGTGCGCAGGGG No data
1160452071_1160452082 27 Left 1160452071 18:78973206-78973228 CCGCTTTCTGAAACTTCTTTGAA No data
Right 1160452082 18:78973256-78973278 CGGCCAGGAAAAGTGCGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160452082 Original CRISPR CGGCCAGGAAAAGTGCGCAG GGG Intergenic