ID: 1160452083

View in Genome Browser
Species Human (GRCh38)
Location 18:78973257-78973279
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160452071_1160452083 28 Left 1160452071 18:78973206-78973228 CCGCTTTCTGAAACTTCTTTGAA No data
Right 1160452083 18:78973257-78973279 GGCCAGGAAAAGTGCGCAGGGGG No data
1160452079_1160452083 -9 Left 1160452079 18:78973243-78973265 CCGGGGAGCTCTACGGCCAGGAA No data
Right 1160452083 18:78973257-78973279 GGCCAGGAAAAGTGCGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160452083 Original CRISPR GGCCAGGAAAAGTGCGCAGG GGG Intergenic