ID: 1160452083 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:78973257-78973279 |
Sequence | GGCCAGGAAAAGTGCGCAGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1160452071_1160452083 | 28 | Left | 1160452071 | 18:78973206-78973228 | CCGCTTTCTGAAACTTCTTTGAA | No data | ||
Right | 1160452083 | 18:78973257-78973279 | GGCCAGGAAAAGTGCGCAGGGGG | No data | ||||
1160452079_1160452083 | -9 | Left | 1160452079 | 18:78973243-78973265 | CCGGGGAGCTCTACGGCCAGGAA | No data | ||
Right | 1160452083 | 18:78973257-78973279 | GGCCAGGAAAAGTGCGCAGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1160452083 | Original CRISPR | GGCCAGGAAAAGTGCGCAGG GGG | Intergenic | ||