ID: 1160452084

View in Genome Browser
Species Human (GRCh38)
Location 18:78973259-78973281
Sequence CGCCCCCTGCGCACTTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160452084_1160452096 27 Left 1160452084 18:78973259-78973281 CCAGGAAAAGTGCGCAGGGGGCG No data
Right 1160452096 18:78973309-78973331 GAGCACGGGGCTCCCCACGCGGG No data
1160452084_1160452088 1 Left 1160452084 18:78973259-78973281 CCAGGAAAAGTGCGCAGGGGGCG No data
Right 1160452088 18:78973283-78973305 CCCCGCGTCGGGCGCGCACACGG No data
1160452084_1160452093 14 Left 1160452084 18:78973259-78973281 CCAGGAAAAGTGCGCAGGGGGCG No data
Right 1160452093 18:78973296-78973318 GCGCACACGGCCAGAGCACGGGG No data
1160452084_1160452091 12 Left 1160452084 18:78973259-78973281 CCAGGAAAAGTGCGCAGGGGGCG No data
Right 1160452091 18:78973294-78973316 GCGCGCACACGGCCAGAGCACGG No data
1160452084_1160452086 -10 Left 1160452084 18:78973259-78973281 CCAGGAAAAGTGCGCAGGGGGCG No data
Right 1160452086 18:78973272-78973294 GCAGGGGGCGTCCCCGCGTCGGG No data
1160452084_1160452092 13 Left 1160452084 18:78973259-78973281 CCAGGAAAAGTGCGCAGGGGGCG No data
Right 1160452092 18:78973295-78973317 CGCGCACACGGCCAGAGCACGGG No data
1160452084_1160452095 26 Left 1160452084 18:78973259-78973281 CCAGGAAAAGTGCGCAGGGGGCG No data
Right 1160452095 18:78973308-78973330 AGAGCACGGGGCTCCCCACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160452084 Original CRISPR CGCCCCCTGCGCACTTTTCC TGG (reversed) Intergenic