ID: 1160452085

View in Genome Browser
Species Human (GRCh38)
Location 18:78973271-78973293
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160452079_1160452085 5 Left 1160452079 18:78973243-78973265 CCGGGGAGCTCTACGGCCAGGAA No data
Right 1160452085 18:78973271-78973293 CGCAGGGGGCGTCCCCGCGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160452085 Original CRISPR CGCAGGGGGCGTCCCCGCGT CGG Intergenic