ID: 1160452086

View in Genome Browser
Species Human (GRCh38)
Location 18:78973272-78973294
Sequence GCAGGGGGCGTCCCCGCGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160452084_1160452086 -10 Left 1160452084 18:78973259-78973281 CCAGGAAAAGTGCGCAGGGGGCG No data
Right 1160452086 18:78973272-78973294 GCAGGGGGCGTCCCCGCGTCGGG No data
1160452079_1160452086 6 Left 1160452079 18:78973243-78973265 CCGGGGAGCTCTACGGCCAGGAA No data
Right 1160452086 18:78973272-78973294 GCAGGGGGCGTCCCCGCGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160452086 Original CRISPR GCAGGGGGCGTCCCCGCGTC GGG Intergenic