ID: 1160452088 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:78973283-78973305 |
Sequence | CCCCGCGTCGGGCGCGCACA CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1160452084_1160452088 | 1 | Left | 1160452084 | 18:78973259-78973281 | CCAGGAAAAGTGCGCAGGGGGCG | No data | ||
Right | 1160452088 | 18:78973283-78973305 | CCCCGCGTCGGGCGCGCACACGG | No data | ||||
1160452079_1160452088 | 17 | Left | 1160452079 | 18:78973243-78973265 | CCGGGGAGCTCTACGGCCAGGAA | No data | ||
Right | 1160452088 | 18:78973283-78973305 | CCCCGCGTCGGGCGCGCACACGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1160452088 | Original CRISPR | CCCCGCGTCGGGCGCGCACA CGG | Intergenic | ||