ID: 1160452088

View in Genome Browser
Species Human (GRCh38)
Location 18:78973283-78973305
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160452084_1160452088 1 Left 1160452084 18:78973259-78973281 CCAGGAAAAGTGCGCAGGGGGCG No data
Right 1160452088 18:78973283-78973305 CCCCGCGTCGGGCGCGCACACGG No data
1160452079_1160452088 17 Left 1160452079 18:78973243-78973265 CCGGGGAGCTCTACGGCCAGGAA No data
Right 1160452088 18:78973283-78973305 CCCCGCGTCGGGCGCGCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160452088 Original CRISPR CCCCGCGTCGGGCGCGCACA CGG Intergenic