ID: 1160453186

View in Genome Browser
Species Human (GRCh38)
Location 18:78979294-78979316
Sequence GGCGGGCGCTCCGGAGTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160453181_1160453186 -3 Left 1160453181 18:78979274-78979296 CCGGTGGCAGCAGCGGGCGGGGC No data
Right 1160453186 18:78979294-78979316 GGCGGGCGCTCCGGAGTCGGTGG No data
1160453170_1160453186 27 Left 1160453170 18:78979244-78979266 CCAGGCGGGCTGGCGCGGGGGCG No data
Right 1160453186 18:78979294-78979316 GGCGGGCGCTCCGGAGTCGGTGG No data
1160453169_1160453186 28 Left 1160453169 18:78979243-78979265 CCCAGGCGGGCTGGCGCGGGGGC No data
Right 1160453186 18:78979294-78979316 GGCGGGCGCTCCGGAGTCGGTGG No data
1160453179_1160453186 -2 Left 1160453179 18:78979273-78979295 CCCGGTGGCAGCAGCGGGCGGGG No data
Right 1160453186 18:78979294-78979316 GGCGGGCGCTCCGGAGTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160453186 Original CRISPR GGCGGGCGCTCCGGAGTCGG TGG Intergenic
No off target data available for this crispr