ID: 1160453312

View in Genome Browser
Species Human (GRCh38)
Location 18:78979680-78979702
Sequence CCGGCGCCTTTGTCTCGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160453312_1160453329 23 Left 1160453312 18:78979680-78979702 CCCGGGCGAGACAAAGGCGCCGG No data
Right 1160453329 18:78979726-78979748 TCGCTCCGGGAGGGGCCGCCCGG No data
1160453312_1160453326 14 Left 1160453312 18:78979680-78979702 CCCGGGCGAGACAAAGGCGCCGG No data
Right 1160453326 18:78979717-78979739 CGCGGCCGCTCGCTCCGGGAGGG No data
1160453312_1160453327 15 Left 1160453312 18:78979680-78979702 CCCGGGCGAGACAAAGGCGCCGG No data
Right 1160453327 18:78979718-78979740 GCGGCCGCTCGCTCCGGGAGGGG No data
1160453312_1160453318 -4 Left 1160453312 18:78979680-78979702 CCCGGGCGAGACAAAGGCGCCGG No data
Right 1160453318 18:78979699-78979721 CCGGGTCGGAGCCCTGCCCGCGG No data
1160453312_1160453322 10 Left 1160453312 18:78979680-78979702 CCCGGGCGAGACAAAGGCGCCGG No data
Right 1160453322 18:78979713-78979735 TGCCCGCGGCCGCTCGCTCCGGG No data
1160453312_1160453332 29 Left 1160453312 18:78979680-78979702 CCCGGGCGAGACAAAGGCGCCGG No data
Right 1160453332 18:78979732-78979754 CGGGAGGGGCCGCCCGGCGGCGG No data
1160453312_1160453325 13 Left 1160453312 18:78979680-78979702 CCCGGGCGAGACAAAGGCGCCGG No data
Right 1160453325 18:78979716-78979738 CCGCGGCCGCTCGCTCCGGGAGG No data
1160453312_1160453321 9 Left 1160453312 18:78979680-78979702 CCCGGGCGAGACAAAGGCGCCGG No data
Right 1160453321 18:78979712-78979734 CTGCCCGCGGCCGCTCGCTCCGG No data
1160453312_1160453330 26 Left 1160453312 18:78979680-78979702 CCCGGGCGAGACAAAGGCGCCGG No data
Right 1160453330 18:78979729-78979751 CTCCGGGAGGGGCCGCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160453312 Original CRISPR CCGGCGCCTTTGTCTCGCCC GGG (reversed) Intergenic