ID: 1160454269

View in Genome Browser
Species Human (GRCh38)
Location 18:78987623-78987645
Sequence TCACACCCATGGTGCCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160454269_1160454274 11 Left 1160454269 18:78987623-78987645 CCAACATGGCACCATGGGTGTGA No data
Right 1160454274 18:78987657-78987679 AGATCAGCTAAGGCGGGTTGTGG No data
1160454269_1160454271 1 Left 1160454269 18:78987623-78987645 CCAACATGGCACCATGGGTGTGA No data
Right 1160454271 18:78987647-78987669 ACTTAATTTGAGATCAGCTAAGG No data
1160454269_1160454272 4 Left 1160454269 18:78987623-78987645 CCAACATGGCACCATGGGTGTGA No data
Right 1160454272 18:78987650-78987672 TAATTTGAGATCAGCTAAGGCGG No data
1160454269_1160454273 5 Left 1160454269 18:78987623-78987645 CCAACATGGCACCATGGGTGTGA No data
Right 1160454273 18:78987651-78987673 AATTTGAGATCAGCTAAGGCGGG No data
1160454269_1160454276 28 Left 1160454269 18:78987623-78987645 CCAACATGGCACCATGGGTGTGA No data
Right 1160454276 18:78987674-78987696 TTGTGGCAGAGCAGGTCCTGAGG No data
1160454269_1160454275 20 Left 1160454269 18:78987623-78987645 CCAACATGGCACCATGGGTGTGA No data
Right 1160454275 18:78987666-78987688 AAGGCGGGTTGTGGCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160454269 Original CRISPR TCACACCCATGGTGCCATGT TGG (reversed) Intronic