ID: 1160454696

View in Genome Browser
Species Human (GRCh38)
Location 18:78992436-78992458
Sequence GTTGGGGGTGCAGGGGCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 553}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160454696_1160454711 18 Left 1160454696 18:78992436-78992458 CCTGCGGCCCCTGCACCCCCAAC 0: 1
1: 0
2: 3
3: 54
4: 553
Right 1160454711 18:78992477-78992499 CAGCACCAACGTGACCCTGGAGG 0: 1
1: 0
2: 1
3: 8
4: 135
1160454696_1160454708 15 Left 1160454696 18:78992436-78992458 CCTGCGGCCCCTGCACCCCCAAC 0: 1
1: 0
2: 3
3: 54
4: 553
Right 1160454708 18:78992474-78992496 GCCCAGCACCAACGTGACCCTGG 0: 1
1: 0
2: 0
3: 24
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160454696 Original CRISPR GTTGGGGGTGCAGGGGCCGC AGG (reversed) Exonic
900013676 1:135479-135501 CTTGGGCCTGCAGAGGCCGCCGG + Intergenic
900043746 1:491462-491484 CTTGGGCCTGCAGAGGCCGCCGG + Intergenic
900044479 1:494548-494570 GTTGGGACTGCAGAGGCCGACGG + Intergenic
900065184 1:726465-726487 CTTGGGCCTGCAGAGGCCGCCGG + Intergenic
900065198 1:726528-726550 TTTGGGCCTGCAGAGGCCGCCGG + Intergenic
900174465 1:1285694-1285716 GTTTGGGCTGCTGGGGCAGCAGG - Intronic
900346393 1:2212505-2212527 GGTGGGGGTGGGGGGGCTGCAGG - Intronic
900410245 1:2509402-2509424 GTTCTGAGTGCTGGGGCCGCTGG - Intronic
900460944 1:2801888-2801910 GTTGGGGGAGAAGGGGCCTGTGG + Intergenic
900544411 1:3220500-3220522 CTTGCAGGTGCAGGGGCCACAGG + Intronic
900649523 1:3724032-3724054 GTGGGGGGTGCAGGGGACTGGGG + Intronic
900808310 1:4782202-4782224 GGTGGGGGTGCCGGGGCATCCGG - Intronic
900812953 1:4821814-4821836 GTTGGGGTTGTAGGGGCCAGGGG - Intergenic
901008430 1:6183343-6183365 GTTGGGGTTGCAGGGGAGGAAGG + Intronic
901167754 1:7231996-7232018 GTTGGGGGTGCATGCGATGCCGG + Intronic
901434100 1:9235492-9235514 GTTGTGGGTGCAGGGGGAGTGGG - Intronic
901436068 1:9248164-9248186 GCTGGGGGGGCAGTGGCCTCGGG - Intronic
901872441 1:12145956-12145978 GTGGAGGGTGCAGGGGCCTGAGG - Intergenic
901953706 1:12769214-12769236 GTTGGGGGTGCAGGAGGAGTTGG - Intergenic
902275135 1:15334256-15334278 GGTGGGGGTGAAGGGGCAGGGGG - Intronic
903101572 1:21035156-21035178 GTTGAGGCTGCAGTGGCCTCAGG - Intronic
903133176 1:21292293-21292315 GTTGGTGGGGGAGGGGGCGCTGG - Intronic
903897769 1:26620359-26620381 GTCGGGGGCGCAGCTGCCGCCGG - Intergenic
905124558 1:35707861-35707883 GGTGGCGGGGCGGGGGCCGCGGG + Intergenic
905851162 1:41276114-41276136 GCTGGGAATGCAGGGGCCACAGG - Intergenic
906143576 1:43547372-43547394 GTAGGGGGTTCAGGGGACTCAGG + Intronic
906197162 1:43936370-43936392 GATGGGGGTGCAGGCGGCGGGGG - Exonic
906615831 1:47232238-47232260 GGCGGGGGAGCGGGGGCCGCGGG - Intergenic
908168742 1:61484167-61484189 GCTAGGGGTGCAGGCGCAGCAGG + Intergenic
908168789 1:61484485-61484507 GCTGGGGGTGCAGGCGCAGCCGG + Intergenic
908569386 1:65392715-65392737 TTTGGGGGTGGAGGTGCAGCTGG + Exonic
908780519 1:67685863-67685885 ATGGGGGGTGACGGGGCCGCGGG + Intronic
909759565 1:79271104-79271126 GTTGGGAGTGTAGGGGCGGGAGG + Intergenic
911000557 1:93160832-93160854 TTTGGGGGGGCAGGGGAGGCAGG - Intronic
911440512 1:97920786-97920808 CTCCGGGGTGCGGGGGCCGCGGG + Intronic
912451939 1:109772813-109772835 GTGGGGAGAGCAGGGGCAGCTGG - Intronic
913250409 1:116908697-116908719 GTTGGGGGGGCAGGGGGAGGCGG - Intergenic
913301225 1:117371459-117371481 GTTGGGGGTGGAGGGGCAGTGGG + Intronic
915234905 1:154473474-154473496 GTTGGGGGGACAGGGGTCGAAGG + Intronic
915367313 1:155323470-155323492 GGTGGGGGCGCAGGCGCAGCTGG + Intronic
915526528 1:156479646-156479668 GCTGGGGGGACAGGAGCCGCGGG + Exonic
915747723 1:158177732-158177754 GTCGGGGGTGGGGGGGTCGCGGG - Intergenic
915977440 1:160400510-160400532 GTGGGGGGTGCAGGGGGCGGGGG - Intergenic
917202554 1:172532986-172533008 GGTGGGGGTGCGGGCGCCGCGGG + Intronic
917802257 1:178581473-178581495 GGTGAGGCTGCAGGGGCAGCTGG - Intergenic
918826969 1:189336834-189336856 GTTGGTGGTCCAGGGGCTTCTGG - Intergenic
919784471 1:201250617-201250639 GGTGGAGGTGCAGGGCCAGCTGG + Intergenic
919795524 1:201319343-201319365 GGTGGGTGTGGAGGGGCGGCTGG + Intronic
919803653 1:201368128-201368150 GTTGAGGGTGCAGGGGCCTCAGG - Intronic
920037511 1:203075705-203075727 GTGGGGGCTGCAGGGTCCCCAGG - Exonic
920436116 1:205948114-205948136 GTTGGGGGTGTGGGGGAAGCAGG + Intergenic
921384021 1:214551702-214551724 GGTGGGGGAGCCGTGGCCGCCGG - Intronic
922100296 1:222473302-222473324 CTTGGGCCTGCAGAGGCCGCCGG + Intergenic
922616882 1:226965839-226965861 GTTGGGGGAGCAGGTGGCGGTGG + Intronic
922734160 1:227970671-227970693 CTTGGGCCTGCAGAGGCCGCCGG - Intergenic
922734949 1:227973774-227973796 CTTGGGCCTGCAGAGGCCGCCGG - Intergenic
923019878 1:230155090-230155112 GTGGGGGGTGCATGCGGCGCGGG - Intronic
923484136 1:234412988-234413010 GTCGGGGGTCGAGGGGGCGCAGG - Intronic
1062843895 10:690024-690046 GTTGGGGGCTCGGGGCCCGCGGG + Intergenic
1064662087 10:17617007-17617029 GTTCCGGGTTCAGGGGGCGCGGG - Intronic
1066733189 10:38451390-38451412 TTTGGGCCTGCAGAGGCCGCCGG - Intergenic
1067801341 10:49361378-49361400 GTTGGTGGTGCTGGGGCCAAGGG + Intergenic
1068497026 10:57795808-57795830 GTTGAGGGTGGAGGGTTCGCCGG - Intergenic
1068584962 10:58787836-58787858 GTGGGGGGTACAGGGGCTCCAGG - Intronic
1068728062 10:60325435-60325457 GTTGGTGGTGGAGGGGCAGGGGG - Intronic
1068954039 10:62805595-62805617 TGTGAGGATGCAGGGGCCGCTGG - Exonic
1069908939 10:71748320-71748342 GGTGGAGGTGCAGGAGCCCCAGG - Exonic
1070398904 10:76035816-76035838 GGCGGGGGAGAAGGGGCCGCTGG - Intronic
1072453171 10:95555272-95555294 GTGGGGGGTGCAGGGGGGCCTGG + Intronic
1072578473 10:96720592-96720614 GCCGCGGGTGCAGGTGCCGCGGG - Intergenic
1075047535 10:119158186-119158208 GTGGTGGGTACAGGGGCTGCCGG + Intronic
1075793000 10:125098899-125098921 GGTGGGGATGGAGGGGGCGCAGG - Intronic
1075829307 10:125391934-125391956 GTTGGGGGAACAGGGGCGGCGGG - Intergenic
1075840347 10:125496745-125496767 GATGGAGGTGCAGGGACTGCAGG + Intergenic
1075869383 10:125758880-125758902 GGTGGGGGTGCAGGAGCAGTGGG - Intronic
1076679166 10:132162904-132162926 GTGGGAGGTGGAGGGGCTGCAGG - Intronic
1076829235 10:132985879-132985901 GGTGGGGGTGCAGGGGGGTCAGG + Intergenic
1076829291 10:132986007-132986029 GGTGGGGGTGCAGGGGGTGGGGG + Intergenic
1076897425 10:133319760-133319782 GATGGGGGTGGAAGGGCCTCTGG - Intronic
1076970020 11:127693-127715 CTTGGGCCTGCAGAGGCCGCCGG + Intergenic
1076994061 11:289770-289792 GATGGGGTGTCAGGGGCCGCGGG - Intronic
1076999600 11:315997-316019 GTCGGGGGTGCGCGGGCCGCGGG + Intergenic
1077051534 11:568926-568948 GTTGGGGGGGGCGGGCCCGCGGG - Intergenic
1077891108 11:6418905-6418927 GTAGGGGCTACAGGGTCCGCCGG + Intronic
1078422066 11:11220745-11220767 CATGGGGGTGGAGGGGCAGCGGG - Intergenic
1079352496 11:19703583-19703605 GTTTGGGCTGCATGGGCAGCTGG + Intronic
1080422840 11:32126931-32126953 ATTGGGGTGGCAGGGGCTGCTGG - Intergenic
1081489851 11:43558747-43558769 GCTGGGGGTGCGGGGGCGGAGGG + Intronic
1081773244 11:45662466-45662488 GGGGGGTGTGCCGGGGCCGCTGG + Intronic
1081803448 11:45875654-45875676 GTTGGGGGTGCAGAGGTCAGAGG + Intronic
1081840880 11:46200638-46200660 CTTGGGGATGCAGGGGTTGCGGG + Intergenic
1081870974 11:46382339-46382361 GCTGGGGGTGCAGGGCCCCCAGG - Exonic
1082807317 11:57459377-57459399 GTTGGGGCTGCTGGAGCCTCAGG - Intergenic
1083160948 11:60853759-60853781 GTTGGAAGTGCAGAGGCCACCGG + Intronic
1083254891 11:61489917-61489939 CGTGGGGATGCAGGTGCCGCAGG - Exonic
1083285581 11:61656598-61656620 GGTGAGGGTGCAGGGGGTGCAGG + Intergenic
1083671704 11:64303676-64303698 GTTGGGGGTTTGGGGGCCACAGG + Intronic
1083770915 11:64866923-64866945 ATGGGGAGTGCAGGGGCTGCGGG + Intronic
1083855486 11:65391023-65391045 ATCAGGGGTGCAGGGGCCGGGGG - Intronic
1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG + Exonic
1084257935 11:67955428-67955450 GCCGGGGGTGCCGGGGACGCGGG - Intergenic
1084528392 11:69711985-69712007 TTTGGGGCAGCAGGGGACGCAGG + Intergenic
1084700505 11:70783703-70783725 GTTGGGGGTGCTGGGTCCACAGG + Intronic
1084792674 11:71484478-71484500 GGTGGGGGTGCAGGGAGCACTGG + Intronic
1085471404 11:76760672-76760694 TTTGGGGGTGCAGGGGCAGCAGG + Intergenic
1087353811 11:97068824-97068846 GTTGGGGGTGGGGGAGCAGCAGG - Intergenic
1088813492 11:113406749-113406771 TCTGGGGGTGCAGGGGAAGCAGG - Intergenic
1089789552 11:120932824-120932846 GTAGAGGGGGCAGGGGCAGCTGG + Intronic
1091320410 11:134645593-134645615 GTTGGGGGAGCAGCCCCCGCTGG + Intergenic
1091404316 12:199481-199503 GTTGGGGGAGCAGCGGCGGCCGG + Intronic
1094843950 12:34353321-34353343 CTTGGGGGCGCAGGGTCCCCTGG + Intergenic
1096153142 12:49327056-49327078 GTTGGGTGTTGAGGGGCTGCTGG + Intronic
1096530915 12:52242436-52242458 GTTGATGGTGCAGGGGCTGAGGG + Intronic
1096840299 12:54375793-54375815 GTGGGTGGGGCAGGGGCAGCAGG - Intronic
1096973667 12:55686202-55686224 GTTGGGGGTCCAGGGACTGTGGG - Intronic
1097057493 12:56258506-56258528 TTCGGGGGTGCAGGGGCTGCTGG - Intergenic
1097090397 12:56500100-56500122 AATGGGGGTGCAGTGGCCTCTGG + Intergenic
1097180106 12:57166963-57166985 GATGGGGATGCAGCGGCCACTGG - Exonic
1097747535 12:63316903-63316925 GGTGGGGGGGCAGGGGGCGGGGG + Intergenic
1100729882 12:97453365-97453387 GCTGGGGGTGGAGGGGGCGCAGG - Intergenic
1101410571 12:104464453-104464475 GTTGGGGGTCAAGGGGGAGCAGG - Intronic
1102005876 12:109588922-109588944 GATGGGGGTTCGGGGGCTGCTGG + Intronic
1102150675 12:110687656-110687678 GTAGGGGGTGGAGGGGTGGCCGG + Intronic
1102220877 12:111193681-111193703 GTGGGGGCTGCGGGGGCTGCCGG + Intronic
1102260098 12:111438212-111438234 GTTGGGGGTGCTGGGGCTGGGGG + Intronic
1102262610 12:111453648-111453670 CGTGTGTGTGCAGGGGCCGCCGG - Intronic
1102688902 12:114745058-114745080 TTTGGGGGTGCGGGTGCTGCTGG + Intergenic
1102790131 12:115637876-115637898 GATGGGGGTGGAGGGGGCTCTGG - Intergenic
1102928644 12:116845802-116845824 GTTGGGGGTGCAGGGGAGAGAGG - Intronic
1103038347 12:117674519-117674541 ATTGGTGGTGCAGGGGCTGGAGG - Intronic
1103530074 12:121595084-121595106 GGTGGCGGTGGAGGGGACGCAGG - Intergenic
1103592803 12:122004237-122004259 GGTGGGGGTGCCGGGTGCGCCGG + Intergenic
1103624435 12:122207241-122207263 CTAAGGGGTCCAGGGGCCGCCGG - Exonic
1104025805 12:125025300-125025322 GCTGGGGTTGCTGGGGCCGCTGG - Exonic
1104038261 12:125113461-125113483 GTGACGGGTGCAGGGGCCACTGG + Intronic
1105015870 12:132786632-132786654 GTGGGAGGTGCGGGGGCCGGGGG - Intronic
1105018727 12:132802383-132802405 ATGGGGGGTGCAGGGGGCACAGG + Intronic
1105514238 13:21076129-21076151 GTGTGGGGAGCAGGGGCCGGAGG - Intergenic
1105542661 13:21328231-21328253 GTTGGGGGTGCTGGCACCTCAGG + Intergenic
1105934943 13:25090021-25090043 GCAGGAGCTGCAGGGGCCGCAGG - Intergenic
1106433886 13:29707375-29707397 GATGGGGCTGCTGGGGCCACAGG - Intergenic
1108682315 13:52790701-52790723 GTTGGGGGTGCAGGCAGGGCTGG - Intergenic
1111056048 13:82952717-82952739 GTTGGGGTTCCAGGTGCCACTGG - Intergenic
1113904949 13:113814875-113814897 TTTGGGGGTGCTGTGGCCCCGGG + Exonic
1113956277 13:114101350-114101372 CGTGGGGGTGCAGGGGGTGCTGG - Intronic
1114450641 14:22822771-22822793 GTTGGGGGGGCGGGGGCGGGAGG + Intronic
1114865999 14:26597152-26597174 GGCAGGGGCGCAGGGGCCGCCGG + Intronic
1117016122 14:51519165-51519187 GTTGGGGTGGCAGGGGGCGGGGG - Intronic
1119441072 14:74629235-74629257 GCTGGGGGTGGAGGGGCTGCAGG - Intergenic
1121279357 14:92688030-92688052 GTTCGCGGTGGAGCGGCCGCAGG + Exonic
1122156452 14:99753201-99753223 GTGGGGGGTGGGGGGGCGGCGGG - Intronic
1122467777 14:101946126-101946148 GTTAGGGGTGCAAGGGCAGGAGG - Intergenic
1122581855 14:102776599-102776621 GTGGAGGGTGCAGGGGGCGCAGG + Intergenic
1122855670 14:104558953-104558975 CTTGGTTCTGCAGGGGCCGCGGG - Intronic
1122970736 14:105151184-105151206 GCTGGGGCTGCTGGGGCTGCTGG - Intronic
1122970742 14:105151202-105151224 GCTGGGGCTGCGGGGGCTGCTGG - Intronic
1202939836 14_KI270725v1_random:136465-136487 GAAGGTGGCGCAGGGGCCGCGGG - Intergenic
1124361042 15:29036580-29036602 GTTTGGGGTGCAGAGACCTCAGG + Intronic
1124635299 15:31361155-31361177 GTGGGGGCAGCAGGGGCCCCTGG + Intronic
1127860225 15:62987960-62987982 TTTGGGCTTGCAGGGGCCTCTGG + Intergenic
1128335232 15:66781408-66781430 GTTGGGGTCGTAGGGGCCGTCGG - Exonic
1128479280 15:68023321-68023343 GTTGGGTGTGCCGGGGCCCAGGG + Intergenic
1128563429 15:68683339-68683361 GGTGGGAGTGCTGGGGACGCGGG - Intronic
1128703653 15:69822329-69822351 GTTTGGGGTGCTGGGGTCCCTGG - Intergenic
1129247694 15:74289676-74289698 CTTGGGGGTGCTGGGGCAGGAGG + Intronic
1129276060 15:74446063-74446085 GCTGGGGGTTCAGGGGAAGCAGG + Exonic
1130101293 15:80896022-80896044 GTTGGGGGCGCAGGATCTGCAGG - Exonic
1130230792 15:82095086-82095108 GTGGGGGGTGCTGGGGCAGGAGG + Intergenic
1130512547 15:84601264-84601286 ATCGGGGCTGCAGGGCCCGCAGG - Intronic
1132196414 15:99917586-99917608 CTTGGGGGTGCTGGGGATGCTGG - Intergenic
1132533817 16:467443-467465 GGAGGAGGTGCAGGGGCCTCAGG + Intronic
1132533846 16:467531-467553 GGAGGAGGTGCAGGGGCCTCAGG + Intronic
1132533913 16:467729-467751 GGAGGAGGTGCAGGGGCCTCAGG + Intronic
1132533942 16:467817-467839 GGAGGAGGTGCAGGGGCCTCAGG + Intronic
1132533964 16:467883-467905 GGAGGAGGTGCAGGGGCCTCAGG + Intronic
1132534040 16:468121-468143 GGAGGAGGTGCAGGGGCCTCAGG + Intronic
1132534048 16:468143-468165 GGAGGAGGTGCAGGGGCCTCAGG + Intronic
1132581664 16:687533-687555 CATGGGGGTGCAGGGGCAGTAGG - Intronic
1132594312 16:741203-741225 GGTTGGGGTGCAGGGGGCGCAGG + Intronic
1132641830 16:981643-981665 GGTGGGGGGGCGGGGGCGGCCGG + Intergenic
1132677901 16:1128251-1128273 GTTGGGGGTCCTGGGGCTGGAGG + Intergenic
1132689176 16:1174907-1174929 GTTGGGGGTGAAGGTGCGGGTGG - Intronic
1132847165 16:2005935-2005957 GCTGGGGGTGGAGGAGCTGCGGG + Intronic
1132999487 16:2841789-2841811 GTTGGGGGGGCGGGGGTGGCAGG + Intergenic
1133026618 16:2991443-2991465 GGTGGCTGGGCAGGGGCCGCAGG + Intergenic
1135158340 16:20073060-20073082 GGTGGACGTGCAGGGGCCACGGG + Intronic
1135495500 16:22948112-22948134 GGTCGGGGTGGAGGGTCCGCTGG - Intergenic
1135579845 16:23616094-23616116 GTTGGGGGAGCAGGGGTCATTGG - Intronic
1136272189 16:29154917-29154939 GTGGGGGGAGTAGGGGCCGCAGG + Intergenic
1136281301 16:29213086-29213108 GTTGGGGGTGCAGGGAGGACGGG - Intergenic
1136355935 16:29744850-29744872 GATGGGGATGCAGGGCCCACAGG + Exonic
1136398883 16:30007144-30007166 GTGGGGGCTGCAGGGGCGCCAGG - Intronic
1138111340 16:54326589-54326611 ATTCGGGGTGTAGGGGCCCCAGG + Intergenic
1138619154 16:58197907-58197929 GCTGGGGGCGCGGGGGGCGCCGG + Exonic
1139534372 16:67562506-67562528 GTCGGCGCTGCCGGGGCCGCGGG - Exonic
1139594153 16:67948423-67948445 GAGGGTGGTGCAGGGGCAGCAGG + Intronic
1139661559 16:68424338-68424360 AATGGGGCTGCAGGGGCCGTAGG + Intronic
1139851084 16:69951902-69951924 GTGGTGGGTGCAGGGGACGTGGG - Intronic
1139880064 16:70174814-70174836 GTGGTGGGTGCAGGGGACGTGGG - Intronic
1139923233 16:70472498-70472520 GTCAGGGCTGCAGGGGCCACAGG - Intronic
1140372447 16:74420703-74420725 GTGGTGGGTGCAGGGGACGTGGG + Intronic
1141089659 16:81121532-81121554 GTTTGGGGTGCAGGGGTGCCTGG - Intergenic
1141489232 16:84360729-84360751 TTTAGGGGTGCTGGGGCCTCTGG + Intergenic
1141800384 16:86304076-86304098 GTTTGGGTTGCAGGCCCCGCAGG - Intergenic
1142075766 16:88116821-88116843 GTCGGGGGAGTAGGGGCCGCAGG + Intronic
1142085670 16:88179014-88179036 GTTGGGGGTGCAGGGAGGACGGG - Intergenic
1142092816 16:88224226-88224248 GGTGGCGGTCCTGGGGCCGCTGG - Intergenic
1142270458 16:89086445-89086467 GGTAGGCGTGCAGGGGCTGCCGG - Intergenic
1142361700 16:89630624-89630646 GCTGGGGGTGCCGGGGCTGGGGG + Intronic
1142361708 16:89630639-89630661 GCTGGGGGTGCCGGGGCTGGGGG + Intronic
1142361724 16:89630669-89630691 GTTGGGGGTGCCGGGGCTGGGGG + Intronic
1142361732 16:89630684-89630706 GCTGGGGGTGCCGGGGCTGGGGG + Intronic
1142361748 16:89630714-89630736 GCTGGGGGTGCCGGGGCTGGGGG + Intronic
1142361756 16:89630729-89630751 GCTGGGGGTGCCGGGGCTGGGGG + Intronic
1142450657 16:90171439-90171461 CTTGGGCCTGCAGAGGCCGCCGG - Intergenic
1142456906 17:62252-62274 CTTGGGCCTGCAGAGGCCGCCGG + Intergenic
1142456920 17:62315-62337 TTTGGGCCTGCAGAGGCCGCCGG + Intergenic
1142623817 17:1180148-1180170 GCTGGGCGAGGAGGGGCCGCGGG + Intronic
1142631516 17:1229240-1229262 GCTGGGGCTGCAGGAGCTGCCGG + Intergenic
1143558268 17:7676103-7676125 GGGGCTGGTGCAGGGGCCGCCGG + Exonic
1143558277 17:7676133-7676155 GCTGCTGGTGCAGGGGCCACGGG + Exonic
1143749973 17:9021218-9021240 CGTGGGGGAGGAGGGGCCGCCGG - Intergenic
1144473282 17:15563254-15563276 GCTGGGGGTTCTGAGGCCGCTGG - Intronic
1144521162 17:15953108-15953130 GCTGGGAGTGCAGGGTGCGCAGG + Intronic
1144586260 17:16489750-16489772 GCTGGGGATGCAAGGGCCGTGGG - Intronic
1144923200 17:18781466-18781488 GCTGGGGGTTCTGAGGCCGCTGG + Intronic
1146357027 17:32142796-32142818 GTTGGGGCTGCAGGGGCGACAGG - Intronic
1146372269 17:32272546-32272568 GTTGGGGGTGCAGAGCCCAAGGG - Intronic
1147654727 17:42082396-42082418 GTTGTGGGAGCAGGGGAGGCTGG - Intergenic
1148615927 17:48999189-48999211 GGGGGGGGTGGGGGGGCCGCGGG + Intronic
1148909158 17:50931234-50931256 GCAGGAGGTGCAGGGGCAGCAGG + Intergenic
1149596992 17:57870095-57870117 GTTGGGGGTGGAGGAGCAGAGGG - Intronic
1151013814 17:70531211-70531233 GTTGGGGGTGGAGGGGTGGAGGG + Intergenic
1151455141 17:74221521-74221543 ATTGGGGGTGCATGGGAAGCAGG + Intronic
1151660739 17:75516724-75516746 GCTGGGGGAGAAGGGGACGCGGG - Exonic
1152089062 17:78237074-78237096 CTAGGGGGTGGAGGGGCCGGAGG + Intronic
1152097037 17:78278408-78278430 GTGAGGGGTGGAGGGGCCGCTGG + Intergenic
1152352694 17:79792326-79792348 GGTGGGTGGGCAGGGGCCGGGGG - Exonic
1152360147 17:79829160-79829182 GTTGGGGGTGTGGTGGCTGCAGG + Intergenic
1152593015 17:81222880-81222902 GTTGGGGGTGGCGGGGCGCCAGG - Exonic
1152597171 17:81243436-81243458 GCTGGGGGTGCAGGGACTCCGGG + Intergenic
1152599543 17:81255056-81255078 TGTGTGGGTGCAGGAGCCGCGGG + Intronic
1152819359 17:82428680-82428702 GTGTGGGGTCCAGGGGCTGCAGG + Intronic
1153707199 18:7757867-7757889 GGTGGGGATGCAGGGGATGCTGG + Intronic
1153970908 18:10226171-10226193 CTTGGGGGGGCAGGGGGCGGGGG - Intergenic
1154413148 18:14153797-14153819 GTTGGGGGTGGAGGGGGGGTGGG - Intergenic
1155096240 18:22559278-22559300 CTCGGGGGTGTAGGGGCAGCGGG + Intergenic
1156269063 18:35514359-35514381 GTTGGGGGTGCAGAGGACAGTGG + Intergenic
1156351342 18:36303864-36303886 TTTGGGGGTGAAGGGGGAGCTGG + Intronic
1156584957 18:38421716-38421738 GTTAGGGTTGCAGGGACCTCGGG - Intergenic
1157128666 18:44982290-44982312 GCTGGGGAGGCAGGGGCCGCCGG + Intronic
1157154883 18:45255802-45255824 GCAGGGGGTGCAGGGGCTGGTGG - Intronic
1157154887 18:45255811-45255833 GAAGGGGGTGCAGGGGGTGCAGG - Intronic
1157593696 18:48851166-48851188 GTTGGGGGAGTAGGGGGAGCAGG + Intronic
1157764203 18:50285187-50285209 GTTGGGTGGGCAGTGGCCGGCGG + Exonic
1158429382 18:57370772-57370794 GTTGAGGGTCCAGGGGTGGCTGG + Intronic
1158893501 18:61893964-61893986 GGAGGGGGTGGCGGGGCCGCAGG - Intronic
1159359410 18:67381409-67381431 GGTGGGGGGTGAGGGGCCGCAGG + Intergenic
1160321484 18:77900215-77900237 ACTGGGGGTGCAGGAGCTGCAGG + Intergenic
1160429628 18:78802561-78802583 GTTGGGGGCGCAGGGGGCTAGGG - Intergenic
1160454696 18:78992436-78992458 GTTGGGGGTGCAGGGGCCGCAGG - Exonic
1160646818 19:197611-197633 CTTGGGCCTGCAGAGGCCGCCGG + Intergenic
1160747498 19:718989-719011 GTGTGGGGTGCGGGGGCAGCAGG - Intronic
1160754589 19:750917-750939 CCTGGGGGTGGAGGGGCAGCCGG + Intergenic
1160777112 19:861452-861474 GATGGGGATGCAGGGGGAGCGGG - Intronic
1160831263 19:1105843-1105865 GGTGGGGGTGGGGGGGCTGCTGG + Intronic
1160837071 19:1129771-1129793 CTTGGTGGTGCAGGGAGCGCAGG + Intronic
1160870578 19:1275994-1276016 GTGGGCGGTGCAGGGGCCACGGG + Intronic
1160881560 19:1323208-1323230 GTTGAGGGTGCAGGAGGCCCTGG + Intergenic
1160967706 19:1753846-1753868 GGTGGGGGCGCCGGGGGCGCGGG + Exonic
1160993630 19:1871946-1871968 GCTGGGGGTGCAGGGGTTGGGGG - Intergenic
1161094437 19:2381556-2381578 GGTGGGGAGGCAGGGGCAGCGGG - Intergenic
1161286009 19:3468572-3468594 GTGGGGGGTGGGGGGGCAGCTGG + Intronic
1161306740 19:3573031-3573053 GGCGGGGGTGCAGGGGTCCCAGG + Intronic
1161470847 19:4456203-4456225 GTGGGGGGTGCTGGGGCCACTGG - Intronic
1161509247 19:4661616-4661638 GATGGGGATGGAGGGGCAGCAGG + Intronic
1161613702 19:5257911-5257933 CTTGGGTGTGCAGGGGACGGGGG + Intronic
1162033137 19:7925883-7925905 GGAGCGGGGGCAGGGGCCGCGGG - Intronic
1162454856 19:10777224-10777246 TTTGGGGGTGCTGGGGAAGCAGG + Intronic
1162585076 19:11553392-11553414 GCTGGGGGGCCAGGGGCTGCAGG + Exonic
1162744753 19:12792123-12792145 GGTGGAGGTGCAGGGGGCGCAGG + Exonic
1162745272 19:12794151-12794173 GGTGGGGGTGCTGGTGCTGCTGG + Intronic
1162909720 19:13842457-13842479 GGTCGGGGTGGAGGGGCCACTGG + Intergenic
1163111122 19:15161393-15161415 GCTGGGGCCGCAGGGGCCCCGGG - Exonic
1163136963 19:15318880-15318902 GTTGGGGGCACAGGGGCCCTGGG + Intronic
1163224911 19:15952826-15952848 ATTGGGGGAGCAGGGGCAGATGG - Intergenic
1163545043 19:17936369-17936391 GATGGGGGAGCAGGGGCCGGAGG - Intronic
1163704141 19:18802637-18802659 GTTGGAGGGGCAGGGGCCAAAGG + Intergenic
1164585630 19:29473077-29473099 AGTGGGGTTGCAGGGGCCGGGGG - Intergenic
1164839276 19:31380477-31380499 AATGGGGGTGCAGGGGAGGCAGG - Intergenic
1165154312 19:33777928-33777950 GTCGGGGGTGCAGGTGTCGGGGG + Intergenic
1165453949 19:35900226-35900248 CCTGGGGGTGCAGGGGCCTGGGG - Intronic
1165807142 19:38587428-38587450 GGTGGGGGTGGAGGGCCAGCTGG - Intronic
1165941041 19:39414985-39415007 GTGGGGGCTGCAGGAGCTGCTGG - Exonic
1166046519 19:40233696-40233718 GCAGGGGCTGCAGGGGCCGCTGG + Exonic
1166416620 19:42599914-42599936 GTTAGGGGAGCAGGGGGAGCAGG + Intronic
1166812478 19:45522513-45522535 GGTGGGGGAGCTGGGGCCCCAGG + Exonic
1167132903 19:47599265-47599287 CTGCGGGGTGCAGGGGCTGCGGG + Intergenic
1167272283 19:48512055-48512077 GGTGGGGGGGCAGGGCCCACGGG + Intronic
1167465887 19:49651023-49651045 GCTGGGGGTGCAGGGGGCGGTGG - Exonic
1167575227 19:50314684-50314706 GTTGGGGGTGAGGGGCCCGGGGG + Intronic
1168277477 19:55285534-55285556 GTTGGGGTGACAGGGGCCGTGGG + Intronic
1168307264 19:55442412-55442434 GCTGGGGGCGCCGGGGGCGCTGG - Exonic
1168536056 19:57171983-57172005 GTCCGGGGGGCGGGGGCCGCGGG + Intergenic
925096252 2:1206407-1206429 GCTGGGTGTGCTGGGGCAGCTGG + Intronic
925943016 2:8837703-8837725 GGCGGGGCTGGAGGGGCCGCGGG + Intergenic
925993005 2:9268983-9269005 GAGTGGGGTGCAGGGGCCGCTGG + Intronic
926217446 2:10914110-10914132 GAGGGGTGTGCAGGAGCCGCAGG + Exonic
926562378 2:14432010-14432032 GCTGGGGGTGGAGGGGAGGCTGG + Intergenic
928100068 2:28431782-28431804 GGTGGGGGTGCTGGGCCCGCTGG - Intergenic
928670513 2:33599021-33599043 ATTGGGGGTGCCGGGGCCAAAGG + Intronic
929808435 2:45169092-45169114 GTGGAGGGTGCAGTGCCCGCAGG + Intergenic
930712207 2:54559618-54559640 CTGAGGGGTGCAGGGGCCGCAGG - Intronic
931253780 2:60553850-60553872 GGAGGGGGCGCTGGGGCCGCGGG + Intergenic
932492918 2:72132972-72132994 GATGGGGGAGCAGGGGCACCGGG - Intronic
932758446 2:74424513-74424535 GTTGGGGGTGCAGGGGCCCAGGG + Intronic
933703106 2:85270051-85270073 GCTGGGCCTGCAGGAGCCGCGGG + Intronic
934650410 2:96088233-96088255 GATGGGGGTGCAGTGGAGGCAGG + Intergenic
934702700 2:96454821-96454843 GTTGGGGTTACAGGTGCCACTGG - Intergenic
935161507 2:100533419-100533441 GTTGGGGCGGCAGGGGCAGGAGG - Intergenic
935793768 2:106619093-106619115 TTTGGGGGTGGAGGGGGGGCAGG + Intergenic
936066944 2:109339591-109339613 GGTGGGGCTGCAGGGGTTGCCGG + Intronic
936255749 2:110909306-110909328 GGTGGGGGTACAGGGGAGGCAGG + Intronic
936899794 2:117469920-117469942 GTTGGGGGGGCGGGGGGAGCTGG - Intergenic
937084273 2:119160181-119160203 GTTGGGGGTGCTAGGGCAGGAGG - Intergenic
937149941 2:119679349-119679371 GCTGGGGGAGGAGGGGCTGCAGG - Exonic
937347070 2:121132609-121132631 GTTGGGGGTGCAGGGGGGGATGG + Intergenic
937922131 2:127138120-127138142 GATGCGGGGGCAGGGGCAGCAGG + Intergenic
938223968 2:129599431-129599453 GTTGGGGGCGCAGGGGGCAAGGG - Intergenic
940682661 2:156806055-156806077 GTTGGCGGTGGGGGGGCCTCAGG + Intergenic
940862700 2:158787140-158787162 TTTGGGGCTTCAGGGGTCGCAGG - Intergenic
940901306 2:159128782-159128804 GTTGGGGGGGCAGGGGAAGAGGG + Intronic
941115992 2:161472715-161472737 GGTGGGGGTGCAGGGGGTGATGG + Intronic
941714402 2:168748823-168748845 GTTGGGGGTGGGGGGGGGGCAGG + Intronic
942323164 2:174753627-174753649 GTAGGGGGTGTCGGGGCAGCAGG + Exonic
943191782 2:184686232-184686254 GTTGGTGGGGCAGGAGCCCCAGG - Intronic
944680421 2:202072318-202072340 GTTGGGGGTGGAGGGGTCAGAGG + Intergenic
946068414 2:217010123-217010145 GTTGGGGGTGCAGAGGACCATGG - Intergenic
947128152 2:226893769-226893791 ATTTGGGGTGCAGGGGCCAAAGG + Intronic
947621676 2:231594803-231594825 GCTGGGGGTGCAGAGGGAGCAGG + Intergenic
947732981 2:232441235-232441257 GTTGGGGGAGGAGGGGCAACAGG + Intergenic
947925142 2:233914762-233914784 GTTGAGGGTCCAGGGGCCACTGG - Intergenic
948381656 2:237554421-237554443 GATGGGGGTGCAGAGGCCACAGG + Exonic
948561878 2:238859633-238859655 GTTGGGGGTGGAGGGGCTAAGGG + Intronic
948612279 2:239177491-239177513 GTTGGGGGTGCCGAGGCCGGAGG + Intronic
948718270 2:239880326-239880348 GTGAGGGGTGCAGGAGCAGCAGG - Intergenic
948746114 2:240095550-240095572 GTCCCGGGTGCAGGGGCCCCTGG + Intergenic
948746172 2:240095729-240095751 GTCTGGGGTGCAGGGGCCACGGG + Intergenic
948765588 2:240217122-240217144 CATGGGGGTGCTGGGGCCCCTGG + Intergenic
948818391 2:240525653-240525675 GTTGGTGGTGCAGTGGCCACCGG + Intronic
949009568 2:241670837-241670859 GTGGGGCGTGCAGGGGTCGAAGG + Intronic
1172167906 20:32910059-32910081 GATGGTGGTGCTGGGGCAGCGGG + Intronic
1174199892 20:48799800-48799822 GGTGAGGGGGCAGGGGCTGCGGG + Intronic
1174585229 20:51603149-51603171 GCTGGGGGAGCAGGGCCCGGAGG - Intronic
1175390909 20:58626716-58626738 CTTGGGGGTGCATGAGCTGCTGG + Intergenic
1175460120 20:59146161-59146183 GTCGGGGTTGCTGGGGCGGCGGG - Intergenic
1175503568 20:59466902-59466924 GCTGGGGCTGCAGGGGCAGGAGG + Intergenic
1175885570 20:62288497-62288519 GCTGTGGGTGCAGAGGCCGGAGG + Intronic
1175885582 20:62288542-62288564 GCTGTGGGTGCAGAGGCCGGAGG + Intronic
1175885593 20:62288587-62288609 GCTGTGGGTGCAGAGGCCGAAGG + Intronic
1175936778 20:62517766-62517788 GTTGGGGGTGCATAGGCTGTGGG - Intergenic
1175949545 20:62576116-62576138 GGAGTGGGTGCAGGGGCGGCGGG - Intergenic
1176051101 20:63120152-63120174 GCTGGATGTGCAGGGGCCCCGGG + Intergenic
1176103693 20:63375942-63375964 GTTGGGGGTGCAGAGGTGGTAGG - Intronic
1176375295 21:6084040-6084062 GCTGGGGGTGCAGGGACAGAGGG - Intergenic
1176550018 21:8217010-8217032 GTCGGGGCGGCAGGGGCCGGCGG + Intergenic
1176568944 21:8400044-8400066 GTCGGGGCGGCAGGGGCCGGCGG + Intergenic
1176576858 21:8444279-8444301 GTCGGGGCGGCAGGGGCCGGCGG + Intergenic
1176583353 21:8550620-8550642 GAAGGTGGCGCAGGGGCCGCGGG + Intergenic
1176861890 21:14015388-14015410 GATGGGGGGGCGGGGGCCTCAGG + Intergenic
1178915901 21:36705444-36705466 ATTGGGGGAGGAGAGGCCGCAGG + Intronic
1179633049 21:42690592-42690614 GACGGGGGTGCAGGAGGCGCAGG - Intronic
1179732307 21:43374674-43374696 CTTGGGTGGGCGGGGGCCGCAGG - Intergenic
1179748179 21:43454204-43454226 GCTGGGGGTGCAGGGACAGAGGG + Intergenic
1179881850 21:44296314-44296336 GGTGGGGGTACAGAGGCCGCAGG - Intronic
1179998524 21:44984888-44984910 GCCGGGGGTGGAGGGGCCGTGGG - Intergenic
1180080796 21:45486797-45486819 GCTGGGGTTGCAGGGCCAGCGGG + Intronic
1180095954 21:45555361-45555383 GTGGGGGTTGCAGGGGCGGCGGG + Intergenic
1180266163 22:10527550-10527572 GAAGGTGGCGCAGGGGCCGCGGG + Intergenic
1180718661 22:17890334-17890356 GGTGGGGGTGGAGGGGCGCCTGG - Intronic
1181038605 22:20181626-20181648 AGTGGGGGTGCAGGGGCCCTGGG - Intergenic
1181729090 22:24831637-24831659 GTTTGGGGTACAGGGGCCATGGG - Intronic
1182809376 22:33103019-33103041 GGGCGGGGGGCAGGGGCCGCGGG - Intergenic
1182885922 22:33774078-33774100 GGTGGGGGTGGAGGGGCGGATGG + Intronic
1183058589 22:35321752-35321774 GCTGGAGGTCCAGGGGCCACAGG + Intronic
1183081301 22:35458398-35458420 GATGGGGGTGCAGGTGCCGGCGG + Intergenic
1183371282 22:37433868-37433890 GTGCGGGGTGCAGTGGCCTCTGG - Intergenic
1183554304 22:38513245-38513267 GCAGGGGGAGCAGGGGCAGCAGG - Intergenic
1183605806 22:38866240-38866262 GCTGGGGTAGCAGGCGCCGCTGG - Exonic
1183645462 22:39123791-39123813 GCAGGGGGTGCAGGGGCAGGCGG + Intronic
1183828889 22:40407720-40407742 ATCGGGGGTGCAGGAGGCGCTGG + Intronic
1184136631 22:42553806-42553828 GCTGTGGGAGCAGGGCCCGCCGG + Intronic
1184148350 22:42624460-42624482 GGTGGGGGTGGGGGAGCCGCAGG - Intronic
1184152985 22:42649264-42649286 GGAGGGGGCGCCGGGGCCGCGGG - Intronic
1184409323 22:44317534-44317556 GTTTGGGGTGTTGGGGCCACAGG - Intergenic
1184460681 22:44636242-44636264 GTGGGGGTTGCAGGGGAAGCAGG - Intergenic
1184510857 22:44932386-44932408 GTTGGGGGTTCAGGGCCCCCTGG - Intronic
1184842903 22:47063076-47063098 GTTCTGGGTGCAGGAGCAGCAGG + Intronic
1185051336 22:48555800-48555822 GATGGGGGCGCTGTGGCCGCTGG + Intronic
1185182597 22:49371995-49372017 GTGGGGGGGGCACGGGCTGCGGG - Intergenic
1185198982 22:49490698-49490720 GTGGGGGCTGCAGGGACCTCAGG + Intronic
1185229312 22:49671038-49671060 GCTGGGGGTGCAGAGGACGCAGG - Intergenic
1185239500 22:49735121-49735143 GCTGGGGCTGCAGGGGAGGCCGG + Intergenic
1185294047 22:50044677-50044699 GTTGGCGGTGCAGGAGGCGCGGG + Intronic
1185301632 22:50084008-50084030 GTGGGTGCTGCAGGGGCTGCCGG + Intronic
1185346682 22:50313556-50313578 GTTGGGGGGGACGGGGCTGCGGG - Intronic
1185371209 22:50461760-50461782 GTTGGGGCTGCGGGGGCCCAAGG - Intronic
1185413425 22:50697565-50697587 GCGGGGGGCGCAGGGGGCGCGGG - Intergenic
1203254908 22_KI270733v1_random:133336-133358 GTCGGGGCGGCAGGGGCCGGCGG + Intergenic
1203262964 22_KI270733v1_random:178415-178437 GTCGGGGCGGCAGGGGCCGGCGG + Intergenic
949648985 3:6132957-6132979 ATTGGTGGTGCAGTGGCCTCAGG + Intergenic
950028762 3:9838132-9838154 GGTGGAGGTGCAAGGGCAGCTGG + Exonic
950633485 3:14299311-14299333 GATGGGGGTGCAGGGGGCAGGGG - Intergenic
950666411 3:14497950-14497972 GGTGGGGGTGCTGGAGCTGCTGG + Intronic
951700438 3:25491261-25491283 GGTGGGGGTGCAGGGGGAGTGGG - Intronic
952226494 3:31382122-31382144 GTTGGGAGTGCAGCAGCAGCAGG - Intergenic
953224284 3:41002273-41002295 GCTGGGGGTGTGGGGGCCGAGGG - Intergenic
954131072 3:48561204-48561226 GGCGGGGCTGCAGGAGCCGCAGG - Intronic
954370312 3:50166666-50166688 GAAGGGGCTGCAGGGACCGCAGG + Intronic
954437434 3:50503489-50503511 GTTGGGGGGGCGCGGGCGGCGGG + Intronic
955536990 3:59934363-59934385 GCAGGGGGTGCAGGGGCAGTGGG - Intronic
955744475 3:62126235-62126257 GTTGGGGAGGCAGGGGCAGGAGG + Intronic
957947443 3:87083152-87083174 GTTGGGGGTGGAGAGGCAGAAGG + Intergenic
960281329 3:115784302-115784324 GCGGGGGGTGCGCGGGCCGCAGG + Intergenic
960721942 3:120633101-120633123 GTGGGGAGTTCAGAGGCCGCTGG + Intronic
961173094 3:124813099-124813121 GTGGGGTGTGCCGGGGCAGCAGG - Intronic
961457744 3:127032604-127032626 GTGGAGGGTGCAGGGGTCGGGGG + Intronic
961779161 3:129311419-129311441 ATTGGGGGTGCAGAGGCTGGAGG + Intergenic
961793773 3:129394890-129394912 TGTGTGGGTGCAGGGGCCGTCGG - Intergenic
962064352 3:131963360-131963382 GCTGGGGTTGCAGGTGCCACTGG - Intronic
962907984 3:139822858-139822880 GGTGGGAGTGCTGGGGCAGCTGG - Intergenic
967479392 3:189956590-189956612 GTTGCTGGTGCAGTGGCCTCAGG - Intergenic
968079196 3:195834916-195834938 GCCGGGGGTGCTGGGGCCCCGGG + Intergenic
968370863 3:198221911-198221933 CTTGGGCCTGCAGAGGCCGCCGG - Intergenic
968512662 4:1002481-1002503 GCTGGGTGAGCCGGGGCCGCTGG + Exonic
968658735 4:1789931-1789953 GGTGGGGGTGCAGGGGGAGTGGG + Intergenic
968813591 4:2810764-2810786 GTTGGGGCTGCAGGGTCCAGAGG - Intronic
968887418 4:3341847-3341869 GTAGGGGCTGCAGAGGCCCCGGG + Intronic
973551237 4:52038125-52038147 GCCGGGGGTGCGGGGGGCGCGGG - Intronic
973759084 4:54100621-54100643 AGTGGGGTGGCAGGGGCCGCAGG + Exonic
975514241 4:75227341-75227363 GTGGGGGGTGCAGGGGGCTAGGG + Intergenic
975689455 4:76949745-76949767 GTGGGGGGAGCAGATGCCGCTGG + Exonic
976828417 4:89285202-89285224 GTTGGGGGGTCAGGGGGCGGGGG + Intronic
977692658 4:99932968-99932990 GCTGGGGGTGCAGGGGAGGGTGG + Intronic
979259323 4:118633571-118633593 CTTGGGCCTGCAGAGGCCGCCGG - Intergenic
979259542 4:118634400-118634422 CTTGGGCCTGCAGAGGCCGCCGG - Intergenic
979328831 4:119406225-119406247 CTTGGGCCTGCAGAGGCCGCCGG + Intergenic
980158582 4:129134106-129134128 GTGGGGGATGCAGGGGCCAGGGG + Intergenic
982484777 4:155953752-155953774 GGTCGGGGTGAAGGGGGCGCGGG + Exonic
983904381 4:173169025-173169047 GTGGAGGGAGCAGGGGCGGCGGG + Intronic
983935512 4:173500291-173500313 CTTGGGGGAGCAGGGCTCGCTGG - Intergenic
985223145 4:187729872-187729894 GTGGAAGGTGCAGGGGCAGCAGG + Intergenic
985549989 5:528196-528218 GTGGGGAGTTCAGGGGCCCCGGG + Intergenic
985862934 5:2488402-2488424 TCTGGGGGTCCAGGGGCCCCAGG - Intergenic
985896139 5:2751067-2751089 GTTCGGCGGGCGGGGGCCGCCGG - Intronic
986437321 5:7747116-7747138 GGTGGGAGTGAAGGGGCCGATGG - Intronic
986565614 5:9110657-9110679 GTAGGGGGTGAAGGAGCCTCCGG + Intronic
989221904 5:38975607-38975629 GTTGGGGGTGGGGAGGCAGCGGG + Intronic
991155691 5:63432273-63432295 GCTGGGGATGCAGGGGACACTGG - Intergenic
991773004 5:70057463-70057485 GTTGGTTGTGCAGGGGCGGGGGG - Intronic
991852297 5:70932887-70932909 GTTGGTTGTGCAGGGGCGGGGGG - Intronic
992530125 5:77645278-77645300 GTAGGGGGTGCCCGGGCGGCGGG - Intergenic
992772255 5:80059747-80059769 GTTGGCGGTGCAGGGGGAGCCGG - Exonic
993900970 5:93584287-93584309 GTCGCGGCTGCAGGCGCCGCTGG - Exonic
995121153 5:108536412-108536434 TCTGGGGGTCCAGGGGTCGCGGG + Intergenic
996542122 5:124641312-124641334 GGTGCGTGTGCAGGTGCCGCTGG + Exonic
996799958 5:127392308-127392330 GTGAGGGGTGCAGGGGCTGCAGG - Intronic
998374812 5:141683163-141683185 GTTGGGGGTGGCGGGGGCGCTGG + Intergenic
999658074 5:153829976-153829998 GTTGGGGGTGGAGGGGTGGGGGG + Intergenic
999731193 5:154477800-154477822 GTGGCGGCTGCAGCGGCCGCGGG + Exonic
1000017031 5:157287147-157287169 GCTGGGCTGGCAGGGGCCGCGGG + Intronic
1001503782 5:172260066-172260088 GTTGGGGGTGGGGGTGCGGCGGG - Intronic
1002640632 5:180629065-180629087 GCCGGGGCTGCAGGGGCCGTGGG - Intronic
1002730097 5:181327467-181327489 CTTGGGCCTGCAGAGGCCGCCGG - Intergenic
1004199615 6:13535660-13535682 GTGGTGTGTGCAGGGGCGGCGGG - Intergenic
1005959263 6:30684553-30684575 GTTGGGGTGGCTGGGGTCGCAGG + Exonic
1006044672 6:31284303-31284325 GCTGGGGGTCCTGGGGCTGCTGG + Intronic
1006517705 6:34553909-34553931 GTGGCGGGTGCGGGGGCCGGGGG - Intronic
1007414766 6:41684871-41684893 GCTGGGTGGGCAGGGGCAGCGGG + Exonic
1009610290 6:65931601-65931623 CTTGGGGGTCCAGGGGCAGGTGG - Intergenic
1011507818 6:88067658-88067680 GGTGGGGGTGTAGGGGGCGATGG + Intergenic
1013225758 6:108118522-108118544 GCAGGGGGCGCAGGGGGCGCAGG + Intronic
1013643754 6:112114623-112114645 GTTGGGTGTGCAGGCTCCCCAGG + Intronic
1014159953 6:118156520-118156542 GTTGGGGGTTGAGGGGCTGGGGG + Intronic
1016965771 6:149717781-149717803 GTTGGCGGGGCGGTGGCCGCCGG - Intronic
1017110467 6:150927778-150927800 GTTGGGGAAGCAGGGGCTGGGGG + Intronic
1017164083 6:151391325-151391347 GGTGGGGGGGCGGGGGCCACCGG - Intronic
1017666136 6:156721678-156721700 GATGGGGGTGCAGGGAAGGCAGG - Intergenic
1017820121 6:158043169-158043191 GATGGGGGAGCAGAGGACGCCGG + Intronic
1018067318 6:160133264-160133286 GTCGTGGGTGGAGGGGCTGCGGG - Intronic
1018719612 6:166562885-166562907 GTTGGGGGTGCAGGGGGCCTGGG + Intronic
1018899355 6:168043441-168043463 GGAGGTGGTGGAGGGGCCGCTGG + Intronic
1018962082 6:168456324-168456346 GTGGGGCGTGGAGGGGCTGCAGG + Intronic
1019036276 6:169062528-169062550 GATAGTGGTGCAGGGGCTGCTGG + Intergenic
1019372786 7:671740-671762 TGTGGGGGTGCTGGGGCCACAGG - Intronic
1019379628 7:714066-714088 GGAGGGAGTGGAGGGGCCGCGGG - Intronic
1019521468 7:1462378-1462400 GGAGGAGGTGCAGGGGCTGCGGG + Intergenic
1019575770 7:1736999-1737021 GGTGGGGCTGCAGGGGTAGCTGG - Intronic
1019667049 7:2257227-2257249 GCTGGGGGTGCAGTGGAGGCAGG - Intronic
1019713810 7:2529409-2529431 GTGGGGGGTGCAGAGGCACCAGG - Intergenic
1021716688 7:23468732-23468754 GGTTGGGGAGCAGGGTCCGCTGG + Intronic
1022047281 7:26631920-26631942 GTTGTGGTTGCAGGGGCAGGTGG + Intergenic
1022748832 7:33202584-33202606 GTTGAGGGTGAAGGGGAAGCAGG + Intronic
1024075242 7:45814607-45814629 TTTGGGCCTGCAGAGGCCGCCGG - Intergenic
1024649101 7:51389581-51389603 CTTGGGCCTGCAGAGGCCGCCGG + Intergenic
1025017363 7:55449819-55449841 TGAGGGGCTGCAGGGGCCGCAGG - Intronic
1025103683 7:56153541-56153563 TTTGGGGGTTCAGGGGTCTCGGG + Intergenic
1025129167 7:56366871-56366893 TTTGGGCCTGCAGAGGCCGCCGG + Intergenic
1025176305 7:56804103-56804125 CTTGGGTCTGCAGAGGCCGCTGG - Intergenic
1025178620 7:56814122-56814144 CTTGGGCCTGCAGAGGCCGCCGG + Intergenic
1025181308 7:56825207-56825229 CTTGGGCCTGCAGAGGCCGCCGG + Intronic
1025227126 7:57175497-57175519 GCTGGGGCTGCTGGGGCTGCAGG - Intergenic
1025230212 7:57198910-57198932 GCTGGGGCTGCAGGGGCTGCTGG - Intergenic
1025690163 7:63749950-63749972 CTTGGGCCTGCAGAGGCCGCCGG - Intergenic
1025690610 7:63751773-63751795 CTTGGGCCTGCAGAGGCCGCCGG - Intergenic
1025691495 7:63755372-63755394 CTTGGGCCTGCAGAGGCCGCCGG - Intergenic
1025691935 7:63757195-63757217 CTTGGGCCTGCAGAGGCCGCCGG - Exonic
1025692383 7:63759018-63759040 CTTGGGCCTGCAGAGGCCGCCGG - Intergenic
1025692827 7:63760841-63760863 CTTGGGCCTGCAGAGGCCGCCGG - Intergenic
1025693244 7:63762520-63762542 CTTGGGCCTGCAGAGGCCGCCGG - Intergenic
1025693687 7:63764343-63764365 CTTGGGCCTGCAGAGGCCGCCGG - Intergenic
1025695487 7:63772319-63772341 CTTGGGTCTGCAGAGGCCGCTGG + Intergenic
1026360966 7:69600108-69600130 GTGGGGGGAGCTGGGGGCGCGGG + Intronic
1026766729 7:73164749-73164771 GCTGGGAGTGCAGGGGCAGGGGG + Intergenic
1026789811 7:73324360-73324382 AGTGAGGGTGCAGGGGCGGCTGG - Intronic
1026931180 7:74223838-74223860 GTGGGGAGTGCAGGGGCACCTGG - Intronic
1027043206 7:74974448-74974470 GCTGGGAGTGCAGGGGCAGGGGG + Intronic
1027080440 7:75227911-75227933 GCTGGGAGTGCAGGGGCAGGGGG - Intergenic
1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG + Exonic
1029389645 7:100266526-100266548 GCTGGGAGTGCAGGGGCAGGGGG - Intronic
1029425373 7:100490943-100490965 GTGAGGAGTGCAGGGGCCTCAGG - Intronic
1029438466 7:100575011-100575033 GTTGGGGCTGAAGGCACCGCAGG + Exonic
1029702418 7:102256102-102256124 GCTGGGCGTGCAGGGCCCGCGGG + Exonic
1032051768 7:128654390-128654412 CTTGGGCCTGCAGAGGCCGCTGG - Intergenic
1033718301 7:144026414-144026436 CCTGGGGGTCCAGGGGGCGCTGG - Intergenic
1034128892 7:148698511-148698533 GTGCCGGGGGCAGGGGCCGCAGG + Intronic
1034263886 7:149772471-149772493 GTGGGGAGGGCAGGGCCCGCGGG - Intronic
1034746431 7:153527742-153527764 GTAAGGGGAGCAGGGGCCTCAGG + Intergenic
1034928872 7:155144541-155144563 GCTGAGGGTGCACGGGCAGCCGG - Intergenic
1035296580 7:157870802-157870824 GGTGGGGGTGCAGGTGCGGGAGG - Intronic
1035664837 8:1373286-1373308 GTGTCGGGAGCAGGGGCCGCGGG + Intergenic
1035998349 8:4574143-4574165 GTTGGGGTTCCAGGAGACGCTGG + Intronic
1036708034 8:11059612-11059634 GCTGGGGGCGCGGGGGGCGCGGG + Intronic
1037209636 8:16370912-16370934 GTTGGGGGGGCGGGGGTCGTGGG + Intronic
1038401444 8:27287614-27287636 CTGGGGGGTGCACGGGGCGCCGG - Exonic
1038768317 8:30451527-30451549 GTTTGGGGTGCAGGGGACAGTGG - Intronic
1041377104 8:57216014-57216036 GGTGGAGGGGCGGGGGCCGCAGG + Intergenic
1042916182 8:73878386-73878408 GTTGCCGGGGCAGGGGCGGCGGG - Intronic
1043052997 8:75405414-75405436 CTTGGGGGTGCGGGGGGCGGGGG - Intergenic
1043601713 8:81947569-81947591 GGTGGGTTTGCAGGGGACGCAGG - Intergenic
1045137321 8:99234519-99234541 GGTTGGGGTTCAGGGGCCGCAGG + Intronic
1045476875 8:102560763-102560785 GCAGGGGCTGCAGGGGCTGCAGG - Exonic
1045476878 8:102560772-102560794 GCAGGGGTTGCAGGGGCTGCAGG - Exonic
1046003291 8:108447204-108447226 GTTGGGGGTGGGGGGGCAGTGGG - Intronic
1046770443 8:118111997-118112019 GTTGGGGGCGTAGGGGGCGCAGG + Intergenic
1049204632 8:141358026-141358048 GCTGGGCGTGCAGGGGCAGACGG - Intronic
1049365599 8:142235381-142235403 GGTGGGGGTGGAGGGGCAGAGGG - Intronic
1049465877 8:142751091-142751113 GTTGGTGGTGCAGGTGGCGATGG + Exonic
1049575900 8:143389440-143389462 GTGGGGGGAGCTGGAGCCGCGGG - Intergenic
1049614584 8:143570526-143570548 GTCGGGGGAGCACGGGCTGCGGG + Exonic
1049691971 8:143965485-143965507 GCTGGGAGAGCAGGGGCCGTGGG - Intronic
1049720864 8:144114912-144114934 GTTGGGCCGGCAGGGGCCGGGGG + Intronic
1050265420 9:3884526-3884548 CTTGGGGGTGCTGAGGCTGCTGG + Intronic
1053872012 9:42502885-42502907 GTTGGGGGTGGTGGGGGGGCAGG - Intergenic
1057313369 9:93954951-93954973 GTTCGGCGTGCAGGCGCTGCTGG - Exonic
1058431708 9:104926650-104926672 GGTGGGGGTGCTGGGCGCGCGGG - Intronic
1058861199 9:109119388-109119410 CTTGGGCGTGCAGGTGCTGCTGG - Exonic
1058997699 9:110315848-110315870 GTTGAGGGGGCGGGGGGCGCAGG + Intronic
1059414262 9:114153784-114153806 ATTGGGGGTGCGGGGGTGGCGGG + Intergenic
1060015733 9:120084804-120084826 GTTGGGGGGGCAGGGGTAGGGGG - Intergenic
1061034922 9:128108081-128108103 CTTGGGAGTGCAGGGGGCTCGGG + Exonic
1061050689 9:128192933-128192955 GTTGGGCGGGCAGGGCGCGCGGG + Intronic
1061492339 9:130952628-130952650 GTGGGGGCTGCAGGTGCCCCTGG + Intergenic
1061499664 9:130994595-130994617 CTCGGTGGTGCAGGGGCCACAGG - Intergenic
1061571665 9:131481596-131481618 GTGGCGGGTGCAGGGGAGGCAGG + Intronic
1061666388 9:132162904-132162926 GTGGGGGGAGCAGAGGCGGCGGG + Intronic
1061860422 9:133465100-133465122 GATGGGTGTGCAGGAGCAGCTGG + Intronic
1061892837 9:133631801-133631823 GCTGGGGGTGCAGGCCACGCAGG + Intergenic
1061903074 9:133683018-133683040 GTGGGGGGTGCAGGGGGTGCAGG - Intronic
1062132996 9:134910255-134910277 GTTGCTGGAGCAGGGGCCTCAGG - Intronic
1062429600 9:136521130-136521152 GGCCTGGGTGCAGGGGCCGCCGG + Intronic
1062502929 9:136858947-136858969 GTTAGGCGTGCAGGAGCCCCAGG + Intronic
1062538548 9:137031526-137031548 GTAGCGGGTGCAGGTGTCGCTGG + Exonic
1062549064 9:137077742-137077764 GCTCTGGGGGCAGGGGCCGCAGG - Exonic
1062754512 9:138279981-138280003 CTTGGGCCTGCAGAGGCCGCCGG - Intergenic
1203471309 Un_GL000220v1:116481-116503 GTCGGGGCGGCAGGGGCCGGCGG + Intergenic
1203479130 Un_GL000220v1:160453-160475 GTCGGGGCGGCAGGGGCCGGCGG + Intergenic
1203578415 Un_KI270745v1:24141-24163 CTTGGGCCTGCAGAGGCCGCCGG - Intergenic
1203613309 Un_KI270749v1:28387-28409 GAGGGTGGCGCAGGGGCCGCGGG + Intergenic
1188002386 X:24994754-24994776 ATTGGGGGTGGGGGGGGCGCGGG + Intronic
1188736779 X:33726742-33726764 GATGGGGATGCGGGGGGCGCGGG + Intergenic
1189114388 X:38327739-38327761 GTTGGAGGTCCAGGCGCCGCAGG + Intronic
1190055779 X:47180235-47180257 GTGGTGGGTGCAGGGCCTGCAGG - Exonic
1190116138 X:47627292-47627314 GCAGGGGGTCCAGGGGCCCCAGG + Exonic
1192181140 X:68916484-68916506 GCAGGGGCTGCAGGGGCCTCGGG + Intergenic
1192234299 X:69286086-69286108 GGGGGGGGTGCGGGGGCAGCAGG - Intergenic
1193030499 X:76892906-76892928 GTTGGGGGGTCAGGGGCTGAGGG + Intergenic
1193797756 X:85897589-85897611 GTTGGTGGGGGAGGGGCAGCAGG + Intronic
1195174905 X:102305840-102305862 GTGGGGGGTGCCGGGGGTGCGGG + Intergenic
1195183960 X:102381253-102381275 GTGGGGGGTGCCGGGGGTGCGGG - Intronic
1195285184 X:103376753-103376775 GATGGGGAAGCAGGGGCGGCTGG + Intronic
1195504792 X:105644755-105644777 GTTGGGGGGGCATGGGAGGCTGG - Intronic
1196800618 X:119540046-119540068 GTGGGGGGCGCTGGGGCTGCTGG - Intronic
1197297493 X:124737026-124737048 GTTGGGGGAGCTGGAGCAGCTGG + Exonic
1197758767 X:130013811-130013833 GACGGAGGGGCAGGGGCCGCTGG - Exonic
1197790505 X:130249224-130249246 CTCAGGGGTGCAGGGGCCCCAGG - Intronic
1198311883 X:135432749-135432771 CTTGGGGCTGTAGGGGCCACAGG + Intergenic
1199674957 X:150180925-150180947 GTTGGCATTGCAGGGGCAGCAGG - Intergenic
1200043803 X:153388850-153388872 GGGTGGGGTGCAGGGGCTGCAGG + Intergenic
1200742355 Y:6868096-6868118 GTATGGGGGGCAGGGGCCGCAGG + Exonic
1200898943 Y:8408112-8408134 GTTGTGGGTTGAGGGGCCGGGGG - Intergenic