ID: 1160454847

View in Genome Browser
Species Human (GRCh38)
Location 18:78992959-78992981
Sequence CTGCGGCGCTGGCGCCGGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 340}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160454847_1160454855 26 Left 1160454847 18:78992959-78992981 CCGCCCCGGCGCCAGCGCCGCAG 0: 1
1: 0
2: 4
3: 36
4: 340
Right 1160454855 18:78993008-78993030 CGCATCCACGCCGCCTGCCCTGG 0: 1
1: 0
2: 0
3: 21
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160454847 Original CRISPR CTGCGGCGCTGGCGCCGGGG CGG (reversed) Exonic
900191779 1:1355171-1355193 CAGCGGCGCGCGGGCCGGGGCGG + Intronic
900402762 1:2479362-2479384 CTGCGGCGCTGGAGCCCTGGAGG + Intronic
900671319 1:3856851-3856873 CTGCGGCGCCGGCCCAGGGCCGG - Intronic
900920629 1:5668003-5668025 CTGAGCCGCTGGTGCAGGGGAGG - Intergenic
900956885 1:5891834-5891856 CTGTGGGGCTGGAGCCTGGGTGG - Intronic
901199166 1:7457039-7457061 CGGCGGCGCAGGGGGCGGGGCGG - Intronic
901405036 1:9039765-9039787 CTGCGGCTCGGGAGCTGGGGAGG - Intronic
901483178 1:9539854-9539876 CTACGGCGCCGGCGCTCGGGAGG + Intronic
901577167 1:10210460-10210482 GTCCGTCGCGGGCGCCGGGGCGG + Intergenic
902308999 1:15566207-15566229 CTGGGGGGCAGGTGCCGGGGAGG - Intronic
903738181 1:25543581-25543603 CGGCGGAGCTGGCGCTGGGAGGG + Exonic
904029984 1:27527891-27527913 GGGCGGCGCTGGGGCCGGCGAGG - Intergenic
904037928 1:27568701-27568723 CCGCGGCGCGGGTGCCCGGGAGG + Intronic
904190058 1:28736691-28736713 CTGGGGCGGTGGGGGCGGGGAGG + Intronic
904215403 1:28914786-28914808 CGGCGGCGCGGGAGCCGGGGCGG + Intronic
905223403 1:36464288-36464310 CCGCGGCGCGGGCCCCGCGGGGG - Exonic
906256545 1:44355037-44355059 CTGCCGCGCTGGCCCCGAGGAGG - Exonic
907091410 1:51729489-51729511 CTGCGGCGCCGGCGCTGCTGGGG - Intronic
909958005 1:81802075-81802097 CTGCGGCGCTGCCTCCCGCGCGG + Intronic
912174686 1:107141235-107141257 CTGCGGCGGTGGCGGCGGCTCGG + Intronic
912471680 1:109911074-109911096 CCGCGGCGCTGGGCCCGGGACGG + Intronic
912514838 1:110211013-110211035 CTGCTGCGCTGCCGCCGCTGCGG + Intergenic
914004213 1:143718215-143718237 CTGCCGCGGTGGAGCCGCGGGGG + Intergenic
915095624 1:153460255-153460277 CTGTGGAGCTGGAGCTGGGGAGG + Intronic
916651773 1:166839907-166839929 CGGCGGCGGTGGCGCAGGCGGGG + Intronic
916890258 1:169106615-169106637 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
919767218 1:201135181-201135203 CTGAGGCGCTGGGGCTGGGAGGG + Exonic
920528482 1:206685273-206685295 CTGCGGCGGCGGGGCCGGGGCGG - Exonic
922766393 1:228158678-228158700 CCGCGGCGCGGGGGCGGGGGCGG - Exonic
924198948 1:241640171-241640193 CTGAGGGGCCGGCGCCGGCGGGG - Exonic
1064208882 10:13347528-13347550 GTGCGGCCCAGGAGCCGGGGAGG + Intronic
1066080709 10:31928527-31928549 CGGCGGCGGCGGCGCCGCGGAGG - Intronic
1067405877 10:46023256-46023278 TTGCAGGGCTGGCGCCGGGCAGG - Intronic
1068538853 10:58269141-58269163 CTACCGCGCAGGCGCCGCGGCGG - Exonic
1069769485 10:70888364-70888386 CTCTGTCGCTGGCGGCGGGGAGG - Intronic
1070764463 10:79048515-79048537 CTGGGGCCCTGGCACTGGGGTGG + Intergenic
1070800828 10:79243548-79243570 CGGCGGCGCGGGGGCCCGGGCGG - Intronic
1071544853 10:86521557-86521579 CGGCGGCGCTCGAGGCGGGGAGG - Exonic
1072710821 10:97714566-97714588 CGGCGGCGCTGCCGTCGGGCGGG - Exonic
1074483991 10:113855051-113855073 GTGAGGGGCTGGCGTCGGGGTGG + Intronic
1074503340 10:114044968-114044990 CGGCGGCGCGGGCGCGGGGACGG - Exonic
1075430311 10:122374829-122374851 CGGCCGCGCTGGAGCAGGGGTGG + Intronic
1075753371 10:124791794-124791816 CGGCGGCGGTGGCGCTGCGGTGG - Exonic
1075859412 10:125661782-125661804 CAGCGGCGCTGCCCCCTGGGAGG + Intronic
1076035530 10:127196216-127196238 CTGCGGCGCGGGGGCCGGCCGGG - Intronic
1076374186 10:129972696-129972718 CTGCGGCGGAGGCGCGGGGTGGG - Intergenic
1076722094 10:132397179-132397201 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1076749890 10:132537420-132537442 CCGCGGCGCGGGGGGCGGGGCGG + Intergenic
1076890701 10:133281831-133281853 CTGCGGCGCCGGCTCCGGGGTGG - Intronic
1077010358 11:376733-376755 ACGCGGCGCTGGGGCCCGGGGGG - Exonic
1077010393 11:376834-376856 CTGCGGCCGTGGGGCCGGGGTGG - Exonic
1077018475 11:407183-407205 CGGCGGCGCAGGGGCGGGGGCGG + Intronic
1077877665 11:6321209-6321231 CTTGGGTGCTGGGGCCGGGGCGG - Intergenic
1080588338 11:33700510-33700532 CGGGGGCGGGGGCGCCGGGGCGG + Exonic
1081733003 11:45384734-45384756 CTGTGGGGCTGGCGTTGGGGAGG - Intergenic
1081938135 11:46918590-46918612 CTGCGGCGCGGGGGGCGGGGCGG - Exonic
1083168387 11:60906271-60906293 CTGCGGCGCCCGGGCCGGGGTGG - Intronic
1083257574 11:61506057-61506079 CTGCCAGGCTGGTGCCGGGGTGG + Intergenic
1083298964 11:61730356-61730378 CTGCAGCCCTGGGGGCGGGGTGG - Intronic
1083334901 11:61916828-61916850 CTGCGGGGCCGGGGCGGGGGGGG + Intronic
1083665013 11:64269499-64269521 GGGCGGCGCTGGCCCCGGGCCGG + Intergenic
1083766460 11:64843751-64843773 CTGTGGCGCCGGGGCCGGGGAGG - Intronic
1083939979 11:65890607-65890629 CGGCGGGGCGCGCGCCGGGGCGG - Exonic
1084087177 11:66860016-66860038 CAGCTGCGCTGCGGCCGGGGCGG - Exonic
1084665322 11:70573265-70573287 CTGCAGCGGTGGGGGCGGGGGGG + Intronic
1085044012 11:73343105-73343127 CTGGGGCGGGGGCGCCGGGGTGG - Intronic
1085717992 11:78889907-78889929 CTGCGGGGCAGGGGTCGGGGCGG + Exonic
1087014622 11:93543236-93543258 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1087761812 11:102110662-102110684 CGGGGGCGGAGGCGCCGGGGCGG + Exonic
1088648445 11:111937119-111937141 CTGCGGCCCGGGCGGGGGGGGGG + Intronic
1090003979 11:122984283-122984305 CTCCCGCGCTGCCGCCGGAGAGG + Intergenic
1090801119 11:130172995-130173017 CTGGGGAGCTGGTGCAGGGGAGG + Intronic
1091226047 11:133956936-133956958 CCGCTGCGCCGGGGCCGGGGAGG - Exonic
1091712736 12:2753238-2753260 ACGCGGCGCTGGCGGCGGGAGGG - Intergenic
1093464857 12:19439405-19439427 CAGCGGGGCGGGCGCCGGGCGGG + Intronic
1096117037 12:49060694-49060716 CTTCGGCGCTAGATCCGGGGGGG + Intergenic
1096788911 12:54033338-54033360 CCGCGGCGCTGCAGGCGGGGCGG - Exonic
1097190474 12:57217042-57217064 CTGGGGCGCTAGCGCGGGCGCGG + Intronic
1098550374 12:71755141-71755163 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1102256426 12:111418195-111418217 CCGCGGGGCCGCCGCCGGGGAGG - Exonic
1103520841 12:121536416-121536438 CTGCGGAGCTGGCAATGGGGTGG + Intronic
1103547522 12:121712717-121712739 GGGCGGGGCGGGCGCCGGGGCGG + Intergenic
1103779573 12:123389580-123389602 CTGCGGCGCGCCCGCCGGGCCGG + Intronic
1103965619 12:124637653-124637675 CTGGGGCGCTGGGACAGGGGTGG - Intergenic
1104049556 12:125186474-125186496 CTGGGGCGCAGGAGCCGCGGCGG + Intergenic
1104985415 12:132593782-132593804 CTGCGGCGATGGCCCCGGCGGGG + Intergenic
1105492611 13:20902935-20902957 CCGCCGCGCTGGGGCGGGGGCGG + Intronic
1105539004 13:21298308-21298330 CTGCGGCGCAGGCGGCGGGTCGG + Intergenic
1106057710 13:26254264-26254286 CTGCGGCGGGAGCGGCGGGGCGG - Exonic
1107654124 13:42574398-42574420 GTGCGGCGCAGGCGGCGGCGGGG - Exonic
1110573011 13:77026774-77026796 CTGCGACGGCGGAGCCGGGGAGG - Intronic
1110596557 13:77326665-77326687 CAGCGCCCCCGGCGCCGGGGAGG + Exonic
1111975960 13:94967795-94967817 TCGGGGCGCCGGCGCCGGGGCGG + Intergenic
1112506990 13:99981403-99981425 CCGCGGCGGGGGCGCCGGGGCGG - Intergenic
1112652562 13:101415851-101415873 CAGCGGCCCTGGTGCCGAGGGGG + Intronic
1113575308 13:111391007-111391029 CTGGGGCACTGGTGCCTGGGAGG + Intergenic
1113602998 13:111584320-111584342 CTGGGGCGGTGGCAGCGGGGTGG - Intergenic
1113803040 13:113096309-113096331 CTGTGGGGCTGCTGCCGGGGCGG + Intronic
1114069839 14:19097929-19097951 CTGCGGCTCCGGCCACGGGGCGG + Intergenic
1114517217 14:23307851-23307873 CTGTGGAGCTGGCCCCGGGGAGG + Exonic
1116817862 14:49599795-49599817 CCGCGGCGCTGCCGCCGCCGCGG - Intronic
1116895515 14:50311972-50311994 CAGCAGCGCAGGCGGCGGGGAGG + Intronic
1119177545 14:72580313-72580335 CTGTGGCCCTGGGGTCGGGGTGG - Intergenic
1119539260 14:75428099-75428121 CGGCGGGGCTGGCGCCGCGGCGG + Intronic
1121368099 14:93332901-93332923 CGGGGGTGCTGGCGCCGGTGCGG - Exonic
1121473634 14:94174840-94174862 CCGCGGGGCTGGCGCCGGTCCGG - Intronic
1122081578 14:99270904-99270926 CTGCGGAGCCGGCTCCGGGCCGG - Intronic
1122620962 14:103057473-103057495 CTGCGGCGGCGGCGGCGGGGAGG - Intergenic
1123037816 14:105478554-105478576 GCGTGGCGCTGGCGCTGGGGAGG + Intronic
1202899773 14_GL000194v1_random:28353-28375 CGCCGGCGCAGGCGCCGGGGGGG - Intergenic
1124189807 15:27564865-27564887 CTGCGGTGCAGGTGCCAGGGAGG + Intergenic
1124439242 15:29674940-29674962 CAGCGGGGCTGGCGGAGGGGCGG - Intergenic
1124922237 15:34038648-34038670 CGGCGGCGCCGGCGCCTGCGCGG - Intronic
1124952639 15:34337837-34337859 CTGCTGCTCTGGCGTCGGGCCGG - Intronic
1127144089 15:56007204-56007226 CGGCGGCGGTGGCGATGGGGCGG + Intergenic
1127988744 15:64095851-64095873 CTTAGGCGCTGGGGGCGGGGCGG - Intronic
1128344131 15:66842825-66842847 CGGCGGCGCCGGCGCGGGCGGGG + Intergenic
1129189137 15:73927410-73927432 CGGCGGCGTGGGCGCGGGGGCGG + Exonic
1129348270 15:74938134-74938156 CTGCGACTCTGGCGCGTGGGCGG + Exonic
1129440563 15:75578556-75578578 CTGGGGCGCGGTCGCCGGTGAGG + Intronic
1131199980 15:90388177-90388199 CTGGGGCGGTGCCGCTGGGGCGG + Intergenic
1132314355 15:100879604-100879626 GCGCGGCGCGGGCGCCGGGACGG + Exonic
1132333089 15:101026084-101026106 CTGTGGCCCTGGAGCCGGAGGGG - Exonic
1132580089 16:680709-680731 CGGCGGCGGTGGCACCGGGGAGG + Intronic
1132943632 16:2520560-2520582 CTGCGGGGCTGGGGACCGGGCGG + Intronic
1133006251 16:2883325-2883347 CCGCGGCGCTGTCGCCGGAGAGG + Exonic
1133011065 16:2912113-2912135 CCGCGGCGCTGTCGCGGGAGAGG + Exonic
1133464741 16:6018976-6018998 CGGCGGCGCTGGCGAGGGGAAGG + Intergenic
1133784358 16:8963370-8963392 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1134042348 16:11078267-11078289 CTGAGTCACTGGCTCCGGGGTGG + Intronic
1134258512 16:12631065-12631087 CAGCAGCGCTGGCTCTGGGGTGG - Intergenic
1134441528 16:14302118-14302140 CAGCGGCCCAGGCGGCGGGGCGG - Intergenic
1136261774 16:29082239-29082261 CTGCGGCGCAGGAGCCGGGGCGG - Intergenic
1136390589 16:29961967-29961989 CTGCGAGGCTGGCGCCCGCGTGG + Intronic
1136560046 16:31033767-31033789 TCCCGGCTCTGGCGCCGGGGAGG + Exonic
1138622429 16:58222708-58222730 CTGCGGAGCTGTCGCCTGCGGGG + Intergenic
1138655244 16:58487704-58487726 CTGCGGCGGGGACGCCCGGGCGG - Intronic
1139534416 16:67562689-67562711 CGGCGGAGCGGGCGCCGCGGGGG + Exonic
1140458010 16:75115764-75115786 CAGCGGGGCGGGCGCAGGGGAGG - Intronic
1141405966 16:83793392-83793414 CTGCGGGGCTGGCTCCAGTGTGG - Intronic
1141428346 16:83957692-83957714 CTGAGCTGCTGGCGCCGAGGTGG - Exonic
1141529094 16:84633834-84633856 CTGCGGAGCTGGAGTCGCGGGGG + Intergenic
1141553180 16:84819807-84819829 CTGAGGCGCGGGCGCCGGGTGGG - Intergenic
1141620504 16:85234740-85234762 CTGCGGGGGCGGAGCCGGGGCGG - Intergenic
1142049935 16:87951611-87951633 CTGCGGCGCGGGCGGCCCGGCGG - Intronic
1142054570 16:87985026-87985048 CGGCAGCGGGGGCGCCGGGGAGG + Intronic
1142142764 16:88479855-88479877 CTGCGGGGGTGGCAGCGGGGGGG - Intronic
1142395313 16:89828446-89828468 CTGAGGCGCTCGCGCGGGGCGGG + Intronic
1203070916 16_KI270728v1_random:1073773-1073795 CAGCGGCGGTGGCGGCGGGGGGG + Intergenic
1142762797 17:2051423-2051445 CCGCGGGCCTGGGGCCGGGGAGG + Intergenic
1142836764 17:2593518-2593540 CTGCGGCGCATGCGCCGGGCTGG - Intronic
1142902105 17:3018476-3018498 CTGCAGGGCTGGCCCCGAGGAGG - Intronic
1143527254 17:7479681-7479703 CGGCGGCGGCGGCGCTGGGGGGG - Intronic
1145928000 17:28662218-28662240 CGGCGGCGGTGGCGGCGGAGGGG + Exonic
1146132635 17:30291964-30291986 CGGCGGCGGCGGCGGCGGGGAGG + Exonic
1146371113 17:32266057-32266079 CTGCGGAGCGGGCGCGGAGGCGG + Intergenic
1147293407 17:39461757-39461779 CTCAGGCCCGGGCGCCGGGGAGG - Intronic
1148178032 17:45584708-45584730 CCGGGGCGCTGGTGCTGGGGTGG + Intergenic
1148698698 17:49575889-49575911 CGGCGCCGCTGGAGCCGAGGGGG + Exonic
1149430471 17:56593192-56593214 CGGCGGCGCTGGAGCCGGGCTGG - Intergenic
1149626354 17:58083349-58083371 CGGCGGCGCGCGCGGCGGGGGGG + Intergenic
1149661869 17:58338296-58338318 CTGCGGCTCTGGGGAGGGGGAGG + Intergenic
1150060583 17:62065369-62065391 CGGCGGCGGCGGCGGCGGGGGGG - Intergenic
1150407920 17:64918994-64919016 CCGGGGCGCTGGTGCTGGGGTGG + Intronic
1150747304 17:67825973-67825995 CCGGGGCGCTGGTGCTGGGGGGG - Exonic
1152553895 17:81043496-81043518 CTGGGGTGCTGGGGCCTGGGCGG + Intronic
1152609905 17:81310300-81310322 CAGCTGCGCAGGGGCCGGGGCGG + Intergenic
1152714179 17:81890751-81890773 CTTCGGCGGTGGTGCCGGCGTGG - Exonic
1152923991 17:83079426-83079448 CGGGGGCGCGGGCGCCGGGGCGG - Intergenic
1154210753 18:12377045-12377067 TTGCGGCTGTGGGGCCGGGGCGG - Exonic
1155199321 18:23503498-23503520 CTGCGGCTCTGGGCCCGGCGCGG - Exonic
1155284260 18:24272048-24272070 CAGCGGCGCTGGGGAAGGGGAGG - Intronic
1156204954 18:34875327-34875349 CTGCGGCGTGTGCGTCGGGGTGG - Exonic
1156448565 18:37253984-37254006 CCGGGGCGCTGCCGGCGGGGAGG + Intronic
1158259107 18:55588152-55588174 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1158649416 18:59272937-59272959 CGCCGGGGCTGGCGGCGGGGAGG + Exonic
1159798106 18:72867785-72867807 CGGCGGCGCCGGCGGCGGCGGGG + Exonic
1160024933 18:75209233-75209255 GGGCTGCGCCGGCGCCGGGGAGG - Exonic
1160256236 18:77250604-77250626 CAGCGGCCCGGGCTCCGGGGCGG - Exonic
1160454847 18:78992959-78992981 CTGCGGCGCTGGCGCCGGGGCGG - Exonic
1160499184 18:79394121-79394143 CTGAGGAGCCGGGGCCGGGGCGG - Intergenic
1160700045 19:501804-501826 CTGGGGGGCGGGCTCCGGGGAGG - Exonic
1160991601 19:1862580-1862602 CCGCGTCGCCGCCGCCGGGGTGG - Intronic
1161450704 19:4343859-4343881 CGGCGGCGGCGGGGCCGGGGCGG + Exonic
1162144441 19:8605247-8605269 CCGCGGCGCTGCCTCCGGGGAGG + Exonic
1162861067 19:13506155-13506177 CTCCGGGGCAGCCGCCGGGGTGG - Exonic
1162954499 19:14090776-14090798 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1163138684 19:15332064-15332086 CTGCGCCGTTGGTGTCGGGGCGG - Intronic
1163282311 19:16325319-16325341 CGGCGGCGGCGGCTCCGGGGCGG - Exonic
1163635144 19:18434030-18434052 CTGGGGCGCGGGTCCCGGGGTGG - Intronic
1163651793 19:18522082-18522104 TGGCGGCGCTGGAGCCGGGAAGG - Exonic
1165080380 19:33303014-33303036 CAGCGGGGCTGGGGCCGGTGGGG + Intergenic
1165311296 19:35030683-35030705 CTGCGGCTCTGGGACCGGCGAGG - Intronic
1165349516 19:35268499-35268521 CGGCGGCGCGAGCCCCGGGGCGG - Intergenic
1165360971 19:35336742-35336764 CTGCAGCGCTGGCTCCGCGTGGG - Intronic
1165862427 19:38916191-38916213 CTGTGCCGCTGGGGACGGGGTGG - Intronic
1166106791 19:40601588-40601610 CAGCGGCGCTCCCGGCGGGGCGG + Intronic
1166304254 19:41928595-41928617 CGGCGGCGGCGGCGCGGGGGAGG + Intronic
1166529735 19:43535121-43535143 CAGCGGTGCGGGCGCTGGGGCGG - Exonic
1167464317 19:49642207-49642229 CTGCGGCTCCGGCCCCGGCGCGG - Exonic
1167592849 19:50413797-50413819 CTGAGGCGATGGCCCTGGGGCGG + Exonic
1167622696 19:50568136-50568158 CGGCGGCGGTGGGGCTGGGGGGG + Intergenic
1168076329 19:53982552-53982574 CGGCGGCGGCGGCGCCGTGGGGG + Exonic
1168352603 19:55685312-55685334 CTGCGACGCGGGCTCTGGGGCGG - Intronic
1168685673 19:58347720-58347742 CTGAGGCGCAGGCGCGGGCGCGG - Intronic
1168685984 19:58350013-58350035 CTGCGGGACCGGGGCCGGGGCGG + Intronic
925090791 2:1154270-1154292 CTGAGGCGCTGGCACGGGCGTGG + Intronic
925161112 2:1685136-1685158 CTGGGGAGCTGGCCCCGGGACGG - Intronic
925959799 2:9003870-9003892 ATGCGGCTGGGGCGCCGGGGCGG - Intergenic
928143518 2:28751577-28751599 CGGTGGCGCAGGCGCCAGGGAGG - Intergenic
928186562 2:29115712-29115734 CGGCGGGGTTGGGGCCGGGGTGG + Intronic
933666855 2:84971274-84971296 CGGCGGCGGCGGCGGCGGGGAGG - Exonic
933684725 2:85133738-85133760 CGGCGGCTCCAGCGCCGGGGCGG + Exonic
933893242 2:86789722-86789744 TCGCGGCGCTGGCGTCGTGGTGG + Exonic
934079118 2:88452460-88452482 CGGCGGCGGTGGCGGCGGGCGGG + Exonic
935692683 2:105745085-105745107 CAGCGGCGCGGGTCCCGGGGCGG - Exonic
936126706 2:109794593-109794615 CGGCGGCGGCGGCGGCGGGGGGG + Intronic
938301115 2:130213667-130213689 CCGGGGCGCTGCCGCCGCGGCGG + Intergenic
939612954 2:144332347-144332369 CCGCGAGGCGGGCGCCGGGGAGG + Intronic
941951601 2:171161210-171161232 CAGCGGCGCTGGAGCCCGAGCGG - Intronic
942045865 2:172099137-172099159 CGGTGGCGCCGGCGCCGGAGGGG + Intergenic
943173329 2:184433110-184433132 CAGCGGGGGTGGCGCGGGGGAGG - Intergenic
945910958 2:215648323-215648345 CTGAGGCACTTGAGCCGGGGAGG + Intergenic
946322470 2:218961804-218961826 CTGAGGCGCCGCGGCCGGGGTGG - Exonic
948002729 2:234581606-234581628 CTGAGGGGCTGGGGACGGGGAGG - Intergenic
948449636 2:238061059-238061081 AGGCGGCCGTGGCGCCGGGGAGG + Exonic
948827123 2:240578203-240578225 CTGGGGCCCTTGCCCCGGGGCGG - Exonic
1168756771 20:324177-324199 CCGCGGCGCGGGGGGCGGGGTGG - Intergenic
1168795881 20:610030-610052 CGGCGGCGCGGGCCCCGTGGTGG - Exonic
1169278646 20:4249429-4249451 CTGCGGCGCTGGCGCGCGCTCGG + Intergenic
1170150380 20:13221376-13221398 CTGCGGGGTCGGCGGCGGGGCGG - Intergenic
1171011498 20:21511855-21511877 CGGCGGCGGTGGCGGCGAGGAGG - Exonic
1171190098 20:23152665-23152687 GTGCGGCCCTGTCCCCGGGGAGG - Intergenic
1172083229 20:32358700-32358722 CTGGGGCGGTGGCGCGGGGCTGG - Exonic
1172698077 20:36835848-36835870 CAGCGGCGGCGGCGGCGGGGAGG - Intronic
1173255566 20:41392341-41392363 CTGCTGCACTGGCCCCAGGGAGG - Intergenic
1173541344 20:43854087-43854109 CTGGGGCGGTGGTGTCGGGGGGG - Intergenic
1174246713 20:49187779-49187801 CTGGGGCGCAGGCGGGGGGGGGG - Intronic
1175847475 20:62066121-62066143 CAGGGGCGCGGGCGCCGGGGCGG + Intergenic
1176005838 20:62861866-62861888 GGGCGGGGCTGGCGCAGGGGTGG - Intergenic
1176062640 20:63178995-63179017 CCGCGGTGCTGGCGGCGGGGCGG + Intergenic
1176286802 21:5022829-5022851 GGGCGGCGGAGGCGCCGGGGCGG + Intronic
1176555708 21:8253269-8253291 CGGCGGCGCGGGCGCAGGGGTGG - Intergenic
1178913340 21:36693529-36693551 CTGGGGCGGTGGCACTGGGGCGG - Intergenic
1179225058 21:39445741-39445763 CTGCGGCGTTGGCGCAGTCGTGG - Intronic
1179870379 21:44240646-44240668 GGGCGGCGGAGGCGCCGGGGCGG - Intronic
1179995008 21:44970138-44970160 CTGCAGCCCTGGCCTCGGGGTGG + Intronic
1180180604 21:46117229-46117251 CTGTGGAGCTGTCTCCGGGGAGG - Intronic
1180874712 22:19169754-19169776 CTGCGGGGCTGAAGCCGCGGAGG + Intergenic
1181037203 22:20175431-20175453 CTGTGGCACTGGCGCCGGATGGG - Intergenic
1181079710 22:20405747-20405769 GCGCGGGGCGGGCGCCGGGGAGG + Exonic
1181256846 22:21568154-21568176 CCGCGGCGCGGGCTCCGGGCAGG - Intronic
1181668490 22:24414321-24414343 CTGTGGCTCTGGGGCAGGGGTGG + Intronic
1181804716 22:25367786-25367808 CTCCGGAGCTGGCCCTGGGGTGG - Intronic
1182115880 22:27756115-27756137 CTGCAGGGCTGGGCCCGGGGAGG + Intronic
1183427066 22:37745916-37745938 CTCCGGCAATGGCGCGGGGGCGG - Intronic
1183903464 22:41022611-41022633 CTGCAGCCCTGGGGCCCGGGAGG - Intergenic
1184121350 22:42452614-42452636 AGGCGGCGCTGGGGCCCGGGCGG - Intergenic
1185298020 22:50063798-50063820 CTGCGGTGCAGGTGCTGGGGAGG - Intronic
949919644 3:8990753-8990775 CTGGGGCCCAGGCCCCGGGGCGG + Exonic
950316346 3:12004742-12004764 CTGCGGCGCGGGCGCCGAGGCGG - Exonic
951717389 3:25664258-25664280 CTGCGGCGCGGGAGCCGGCGTGG - Exonic
952451780 3:33440123-33440145 CTGCAGCGCTAGCGGCGCGGGGG - Exonic
954004217 3:47578863-47578885 CGGCGGCGCGGGAGGCGGGGAGG - Exonic
954540633 3:51391266-51391288 GCGCGGCGGTGGCGGCGGGGCGG - Exonic
954632771 3:52056237-52056259 GTCCGGCGCAGGCACCGGGGCGG - Exonic
954735751 3:52705615-52705637 CTGCGGCGCGGGCGCTGAGCTGG - Exonic
954778998 3:53045744-53045766 GGGCGGCGGCGGCGCCGGGGCGG - Intronic
955818796 3:62874852-62874874 CGCCGGCGCCGGAGCCGGGGTGG - Exonic
956813648 3:72888410-72888432 CTCCCGGGCTGGCCCCGGGGAGG - Exonic
960120835 3:113947792-113947814 CCGCGGCCCTGGCGCCGGGAAGG - Intergenic
960602121 3:119468971-119468993 CTGCGGCGCTGGCGGAAGCGCGG - Exonic
961742444 3:129041048-129041070 GTGCAGAGCTGGCCCCGGGGAGG + Intergenic
961913501 3:130345861-130345883 CTGCGCCGCGGGCGCCCGAGAGG + Exonic
962277954 3:134030034-134030056 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
966182289 3:177197848-177197870 CCGCGGCGGTGGGGGCGGGGCGG - Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968178189 3:196569041-196569063 CGGCGGCGCGGGCGCGGGCGCGG + Exonic
968186961 3:196639634-196639656 GCGCGGCGCGGGCGCGGGGGTGG - Intergenic
968674719 4:1871352-1871374 CTGCGGCGGCGGCGGCGGGCGGG + Intergenic
968879819 4:3293106-3293128 GTGCGGGGCCGGGGCCGGGGCGG + Intronic
969379293 4:6783298-6783320 TTGCGGCTCTTGCGCCCGGGTGG + Intronic
969391411 4:6893663-6893685 CTGCCACGCTGGAGCTGGGGTGG - Intergenic
969436590 4:7192609-7192631 CAGCGGAGCCGGCGGCGGGGCGG - Exonic
969673132 4:8600761-8600783 CTGCGGCTGTGGCTCCTGGGTGG + Intronic
971279814 4:25233944-25233966 CTTCTGCGCAGGCGCGGGGGTGG + Intronic
975778967 4:77819622-77819644 CGGCGGCGGCGGCGACGGGGCGG + Intergenic
978340916 4:107720440-107720462 CTTCAGCGCTCGCGCCGGCGCGG + Exonic
978619042 4:110621565-110621587 GTGCGGCGCTGGGGGAGGGGAGG - Intronic
978795747 4:112705997-112706019 CTGCGGCGCAGGAGCCGGGGCGG + Intergenic
980130363 4:128811619-128811641 CTGCGCCGCCCGGGCCGGGGTGG + Intronic
981713559 4:147732021-147732043 CTGCCGCGCGGGGGCCGGGCGGG + Intergenic
984734782 4:183099110-183099132 CTGCGGCGCTGCCGCGGCAGCGG - Intergenic
984734857 4:183099381-183099403 CCGCGACGCGGGCGCCGGCGAGG - Exonic
985555303 5:555196-555218 CTTCCTCGCGGGCGCCGGGGCGG + Intergenic
985576654 5:676390-676412 ATGGGGCGCTGGCGCCGCAGAGG + Intronic
985635954 5:1036017-1036039 CTGCGGCTCTGGTGCCTGGGAGG + Intronic
990581766 5:57173291-57173313 CTGCCGAGCCGGCGCCGGAGCGG - Intergenic
992086340 5:73281314-73281336 CTGAGGCGATGGAGCGGGGGCGG + Intergenic
992939950 5:81751527-81751549 CGGCGGAGCTGGAGCCGTGGCGG + Intronic
994147239 5:96409228-96409250 CTTCGGTGCTGGAGCCTGGGTGG - Intronic
994353872 5:98774012-98774034 CGGCGGCGCGGGCGCCGTGGCGG - Exonic
996298570 5:121954208-121954230 CAGCGGCGCCGGCGCGGGCGCGG + Intergenic
997912430 5:137889321-137889343 CTGCGCCGCAGGAGCCCGGGAGG - Intronic
997990801 5:138543130-138543152 CCGCGGAGCCGCCGCCGGGGAGG - Exonic
1002029366 5:176416538-176416560 CTGCGGTGCGGGCGCCGCGGCGG + Exonic
1002591067 5:180291966-180291988 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
1002927251 6:1611579-1611601 CGGCGGCGCGGGGGCCGCGGGGG + Exonic
1003871161 6:10404438-10404460 CCACTGCGCTTGCGCCGGGGCGG - Intronic
1004504728 6:16238654-16238676 CTGCGGCGGCGGCGACGGCGGGG - Exonic
1005987563 6:30884216-30884238 CAGCGGCGCGGGCGGCTGGGCGG + Intronic
1006579265 6:35067246-35067268 CTGTGGGGCTGGCCCGGGGGTGG - Intronic
1006682363 6:35806116-35806138 CTGCAGCTGTGGCCCCGGGGTGG - Intronic
1007363214 6:41373197-41373219 CTCCGGCGCGGGGGCTGGGGCGG - Intergenic
1007590675 6:43018910-43018932 CAGCAGCACTGGCGCCGGCGGGG - Exonic
1007665328 6:43510041-43510063 GGGCGGCGCTGGGGCGGGGGCGG + Exonic
1013007389 6:106086423-106086445 CTGGGACGCGGGCGCCCGGGCGG + Exonic
1013230510 6:108157782-108157804 CTGCGGCGGGGGCGGCCGGGCGG - Intronic
1013306104 6:108848448-108848470 ATGCAGCGCTGGCGCGGGCGGGG - Exonic
1014018654 6:116564012-116564034 CTGCAGCCCTGGAGCCGGCGAGG + Intergenic
1014844460 6:126258310-126258332 CGGCGGCCCTGGCCCCAGGGCGG - Intergenic
1015149272 6:130019997-130020019 CGGCGGCGGCCGCGCCGGGGCGG + Intronic
1015843049 6:137493493-137493515 CTGCAGCGCGGGCGGCGTGGAGG + Exonic
1017470459 6:154733482-154733504 CTGCGGCCCGAGCGGCGGGGAGG + Exonic
1017671972 6:156777715-156777737 CGGCGGCGCGGGCGCGGGCGCGG + Intergenic
1017906119 6:158758553-158758575 CAGCTGCGCTGGCTCCGGAGAGG - Intronic
1019189556 6:170243822-170243844 CAGCGGGGCAGGCGTCGGGGAGG + Intergenic
1019537416 7:1536491-1536513 CTGCGTCTCTGGCCCTGGGGTGG + Intronic
1019905176 7:4057113-4057135 CTGCGGCCCTGCTGCTGGGGAGG - Intronic
1019989550 7:4682244-4682266 CGGCGGCGCGGGGGGCGGGGAGG - Intergenic
1020046713 7:5046067-5046089 CGGCGGCGCTGGGGCCAGAGGGG + Exonic
1020238470 7:6374473-6374495 CGGCGGCGCCGGCGCGGGGGAGG + Intergenic
1023287102 7:38631389-38631411 CAGCGGGGCTGGCGGCGGCGCGG + Exonic
1023955626 7:44884859-44884881 CTTCGGCGCGGGCCCCGGGCCGG - Exonic
1026727267 7:72879563-72879585 CAGCGGCGCTGGGGCCAGAGGGG + Exonic
1026825405 7:73578457-73578479 CGGCGGCGGTAGCGCGGGGGTGG - Exonic
1027116562 7:75486071-75486093 CGGCGGCGCTGGGGCCAGAGGGG - Exonic
1027121889 7:75527892-75527914 CGGCGGCGCTGGGGCCAGAGGGG - Intergenic
1027275239 7:76549539-76549561 CGGCGGCGCTGGGGCCAGAGGGG + Intergenic
1029640397 7:101816391-101816413 CGGCGGCGCGGGGCCCGGGGGGG - Intronic
1029720948 7:102364089-102364111 CGGCGGCGCTGGGGCCAGAGGGG + Exonic
1029996465 7:105012878-105012900 TTGGGGCGCTGGCGCGGAGGAGG - Intergenic
1031043551 7:116862922-116862944 CGGGGGCGCGGGCGCGGGGGAGG + Intronic
1033657001 7:143381352-143381374 CTGCGGACCCGGCGCCGAGGCGG + Exonic
1034951054 7:155297540-155297562 CCGCGGAGCTGGGGCCTGGGAGG - Intergenic
1034951285 7:155298348-155298370 CCGCGGCGCTGGCTCGCGGGGGG - Exonic
1035212104 7:157336538-157336560 CTGGGGCGCGGGCGCGGGCGCGG - Intronic
1035327677 7:158075491-158075513 CTGCTGCGTTGGGGGCGGGGAGG - Intronic
1035403914 7:158586740-158586762 CGGCGGCGCTGCCCGCGGGGGGG + Intronic
1035527549 8:325573-325595 CTGGGGGGCTGGGGCCTGGGAGG - Intergenic
1035751862 8:2002085-2002107 CCGCGGCGCTCGGGCCGGCGGGG + Exonic
1036032670 8:4991541-4991563 CTGCGCCGCGCGCGCCCGGGTGG - Intronic
1036785308 8:11681480-11681502 GTGCGGCGCTCGCGGGGGGGGGG + Intronic
1037273782 8:17156664-17156686 CCGCGGGCCTGGCTCCGGGGCGG - Exonic
1037876524 8:22551554-22551576 CCGCAGGGCTGGCGTCGGGGAGG - Intronic
1041271969 8:56117784-56117806 TTGCTGCGCTGGGGCCGAGGAGG + Intergenic
1042040128 8:64581063-64581085 CGGCGGCGGCGGCGGCGGGGTGG + Exonic
1043563478 8:81522259-81522281 CGGCGGCGCTGGAGCGGCGGCGG + Intergenic
1045336246 8:101206102-101206124 CTGAGGCGCTGGCCCGGGAGCGG + Intronic
1045432132 8:102124107-102124129 GTGCGCCGCGGGCGCAGGGGTGG - Intronic
1047000977 8:120571996-120572018 CAGCGGGGGTGGGGCCGGGGAGG - Intronic
1049614043 8:143568652-143568674 CTGGTGCGCCGGGGCCGGGGCGG - Exonic
1049689785 8:143953444-143953466 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1049694536 8:143976910-143976932 CGGCGGGGCTGGGGCCCGGGCGG + Intergenic
1056475395 9:86947231-86947253 CGGCGGCGGTGGCGGCGGCGAGG - Intergenic
1057223009 9:93267895-93267917 CTGCGGCCTGGGCACCGGGGAGG + Exonic
1057488721 9:95506374-95506396 CGGGGGCGCGGGCGCCGCGGCGG + Intronic
1058005146 9:99906585-99906607 CTGCGGGGCGGGGGCGGGGGCGG + Intergenic
1060811764 9:126614354-126614376 CCGCGGCCCTGGAACCGGGGAGG - Intergenic
1060897013 9:127224869-127224891 CCGCGGGGCTGGCGCGGGAGGGG + Intronic
1061061002 9:128250550-128250572 CTGGGGCGTTGGCGCCGCTGGGG + Intronic
1061330145 9:129887080-129887102 CTGGGGAGCTGGCCCCTGGGAGG - Intergenic
1061513685 9:131076265-131076287 CTGGGGCGCCGGGGCCAGGGGGG - Intronic
1062022556 9:134326350-134326372 CTGCGGCGCCGGCGGGGGGGTGG - Intronic
1062462115 9:136666362-136666384 CTGCGGGGCTGCTGCCGGGCAGG + Intronic
1185495901 X:554583-554605 AAGCGGAGCTGGCTCCGGGGTGG - Intergenic
1185890172 X:3815876-3815898 CTGCGCCGCAGGCCTCGGGGCGG + Intergenic
1189324663 X:40105330-40105352 CTGCGGCGGCGGCGGCGGGGCGG - Intronic
1199772596 X:150984039-150984061 CGGCGGCGGCGGCGCCGGGCGGG - Intronic
1200080851 X:153575634-153575656 CCACGGGGCTGGGGCCGGGGGGG + Intronic
1200129040 X:153831013-153831035 CGGGGGCGCTGGAGCCGGCGCGG + Intergenic