ID: 1160454920

View in Genome Browser
Species Human (GRCh38)
Location 18:78993330-78993352
Sequence CCCTTCAAGTGCAACATCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160454916_1160454920 5 Left 1160454916 18:78993302-78993324 CCACCTGCGCTCGCACACAGGCG 0: 1
1: 0
2: 6
3: 12
4: 122
Right 1160454920 18:78993330-78993352 CCCTTCAAGTGCAACATCTGCGG 0: 1
1: 1
2: 1
3: 12
4: 125
1160454917_1160454920 2 Left 1160454917 18:78993305-78993327 CCTGCGCTCGCACACAGGCGAGC 0: 1
1: 1
2: 15
3: 37
4: 95
Right 1160454920 18:78993330-78993352 CCCTTCAAGTGCAACATCTGCGG 0: 1
1: 1
2: 1
3: 12
4: 125
1160454914_1160454920 11 Left 1160454914 18:78993296-78993318 CCAGATCCACCTGCGCTCGCACA 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1160454920 18:78993330-78993352 CCCTTCAAGTGCAACATCTGCGG 0: 1
1: 1
2: 1
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160454920 Original CRISPR CCCTTCAAGTGCAACATCTG CGG Exonic
901081842 1:6588154-6588176 CCCTTCCAGTGCCACCTCTGTGG + Exonic
904929093 1:34072367-34072389 CCCTTGAAGAGCAAATTCTGTGG + Intronic
909596753 1:77414309-77414331 CCCTTAAACTGCACCCTCTGAGG - Intronic
911246866 1:95527717-95527739 ATCTACAAGTGCAAGATCTGGGG - Intergenic
912501742 1:110127187-110127209 CCCTTCAGGTGAAGCCTCTGCGG + Intergenic
1063090250 10:2859137-2859159 TTCTTCAAGTGCAACTTCTCAGG + Intergenic
1067568586 10:47355368-47355390 TCCTTCAGGTTCAACATCGGTGG + Exonic
1071280000 10:84092821-84092843 CCTTGAAAGTGCCACATCTGAGG + Intergenic
1071370202 10:84943592-84943614 TTATTCAAGTGCAACATTTGAGG - Intergenic
1072490747 10:95903942-95903964 ACCTTAAAGAGCAACAACTGCGG + Intronic
1074780835 10:116800782-116800804 CCATTCAAATGCAAACTCTGAGG + Intergenic
1075064004 10:119277108-119277130 GTCTTCAAGTGCAGCATCAGTGG + Intronic
1076372951 10:129966844-129966866 CCCATCAAGTCGAAAATCTGAGG - Intergenic
1077475313 11:2787056-2787078 CCCTTCCATTGCCACATATGTGG + Intronic
1077714547 11:4568552-4568574 CCCTGCAAAGCCAACATCTGGGG - Intergenic
1082102342 11:48183129-48183151 CCCTTCCAGAGCAACCTGTGTGG + Intergenic
1083044661 11:59723275-59723297 TGCTTCAAGTAAAACATCTGGGG + Intronic
1083200810 11:61119928-61119950 CCCTCCAAGTGCCCCATCTTTGG - Intronic
1089658866 11:119972616-119972638 CCCTTCTAGTGGAATATTTGAGG + Intergenic
1090694358 11:129222686-129222708 CTCTTTAAGTGCAACCTCTCTGG + Intronic
1097022768 12:56032584-56032606 CCCTACAAGTGTAACTACTGTGG + Exonic
1097023236 12:56035242-56035264 CCTTTTGAGTGCAACATCTGTGG + Exonic
1099939948 12:89174749-89174771 CCCTCCAAGAGCATCCTCTGAGG - Intergenic
1102888030 12:116536266-116536288 CCATTCTAGGGCAACATCTGTGG + Intergenic
1108142302 13:47436594-47436616 CCCTTCAAGGACCACAGCTGTGG - Intergenic
1108594076 13:51935564-51935586 CCCCTCAGGTGGAGCATCTGTGG - Intronic
1113330776 13:109325082-109325104 CACTTACAGAGCAACATCTGTGG - Intergenic
1114317759 14:21523734-21523756 CCCTTCAAATGCAAAGTGTGTGG - Exonic
1114317890 14:21524508-21524530 CCCTATAAGTGCAATGTCTGTGG - Exonic
1114535747 14:23421186-23421208 CCCTGGAAGTGTAACACCTGCGG + Intronic
1114692885 14:24601251-24601273 CCACTCAAGTGCACCATCTGGGG - Intergenic
1119115254 14:72014497-72014519 GGCATCAAGTGCAACAACTGAGG + Intronic
1124139993 15:27068677-27068699 CCCTGCCAGTGCAACATGTAAGG - Intronic
1125171317 15:36769440-36769462 GCCTTGAAGAGCAAAATCTGAGG - Intronic
1129117228 15:73371184-73371206 CCCATCAAGGGCAAGACCTGGGG - Intergenic
1129912528 15:79240296-79240318 CCACTCAATTCCAACATCTGTGG + Intergenic
1132897192 16:2234709-2234731 CCGTTCAAGTGCTACAAGTGCGG + Exonic
1133077336 16:3289887-3289909 CCCTATCAGTGCAACATTTGCGG + Exonic
1136622213 16:31436734-31436756 CCCTGCAAGTGCAAGGCCTGCGG - Exonic
1137786231 16:51140003-51140025 CCCTTTAAGTGTAAGATCTGTGG - Exonic
1137786379 16:51140774-51140796 CCATTCAAGTGCAACATCTGCGG - Exonic
1138568399 16:57850821-57850843 CCCTTCCAGTGCTTCAGCTGTGG + Intronic
1140794553 16:78424947-78424969 CCTTTCAAGTGAATCATCTGGGG + Exonic
1141714393 16:85718398-85718420 GCCTCCAAGTGAAACGTCTGGGG - Intronic
1141752702 16:85969768-85969790 CCCTGCAAGTTTAACCTCTGTGG + Intergenic
1142183088 16:88681147-88681169 CCCTGCACCTGCAAGATCTGTGG - Exonic
1142918698 17:3165065-3165087 CAATTCCAGTGCAACATCTCAGG - Intergenic
1144594125 17:16552181-16552203 CCCTTTAAATGCAATATATGTGG - Exonic
1145781368 17:27566097-27566119 TCCTTCCAGTGAATCATCTGGGG - Intronic
1146355926 17:32134230-32134252 CCCTTGAATACCAACATCTGAGG + Intergenic
1146532346 17:33619419-33619441 AGGTGCAAGTGCAACATCTGAGG + Intronic
1147342934 17:39765863-39765885 CCTTTCGAGTGTAACATGTGTGG - Exonic
1148043418 17:44726634-44726656 CCCTTCATATGCATCATTTGCGG + Intronic
1150641084 17:66949985-66950007 CCCATCAAATAGAACATCTGAGG - Intergenic
1152174195 17:78776291-78776313 CCCTTAAAGTGCATTATATGTGG + Intronic
1155245940 18:23909030-23909052 CCCATCCTGTTCAACATCTGGGG + Intronic
1157688831 18:49664412-49664434 CCCTTAAAGTGCTGCAGCTGAGG - Intergenic
1160214277 18:76913823-76913845 CCCTACAAGTGCAAGCTCTGTGG + Exonic
1160454920 18:78993330-78993352 CCCTTCAAGTGCAACATCTGCGG + Exonic
1160455097 18:78994107-78994129 CCGTTCAAGTGCAAGATCTGCGG + Exonic
1165610921 19:37151644-37151666 CCCTACAAGTGTGGCATCTGTGG - Exonic
1165614290 19:37185282-37185304 CCCTACAAGTGTGGCATCTGTGG - Exonic
1166628706 19:44385952-44385974 CCCTTCAAATGCCACTTCTATGG + Exonic
1167845122 19:52156508-52156530 CCATACAAATGCAACATATGTGG - Exonic
1167879231 19:52441824-52441846 CCTTACAAATGCAACATATGTGG + Intronic
1168315463 19:55483054-55483076 CCCTTCACCTGCCCCATCTGCGG + Exonic
1168334991 19:55592514-55592536 CCCTTCCCTTGCCACATCTGCGG - Exonic
1168339575 19:55615431-55615453 CCCTACAAGTGCGAGCTCTGCGG + Exonic
1168344793 19:55644911-55644933 CCCTTCGAGTGTGACATCTGTGG + Exonic
1168644995 19:58053959-58053981 CCCTTCCAGTGTAGCGTCTGCGG + Exonic
1168700291 19:58434719-58434741 CTCTTCGAGTGCAGCAACTGTGG - Exonic
926183420 2:10666843-10666865 CCATTCAAGTGTTACCTCTGGGG + Intronic
933765396 2:85705102-85705124 TCCTTAAGGTGCAACATCAGAGG - Intergenic
938140393 2:128790257-128790279 CCCTTCAAGATAAACATTTGTGG + Intergenic
943757182 2:191569012-191569034 CCTTTAAAGTGGACCATCTGTGG + Intergenic
946467489 2:219925019-219925041 TCCTTCTAGTACAACATCAGGGG + Intergenic
946648398 2:221865332-221865354 CCCTTTAAGGCCAACATTTGGGG + Intergenic
1169375882 20:5066273-5066295 CCCTTCATGTCCAACATTAGAGG - Intergenic
1172158725 20:32849416-32849438 CTCTTCAACTGTAACATCTCAGG - Exonic
1173812313 20:45963594-45963616 CCCTTCCTGTGCCGCATCTGTGG - Exonic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1175363725 20:58435674-58435696 GCCTACAAGTGAAACATCAGCGG - Intronic
1180737150 22:18025559-18025581 CCCTTCATGTCCATCATGTGAGG + Intergenic
1181079813 22:20406360-20406382 CCCTTCAAGTGCGCCGACTGCGG + Exonic
1181079826 22:20406444-20406466 CCCTTCAAGTGCAACGAGTGCGG + Exonic
1181235677 22:21446489-21446511 CCCTTCCCCTGCAACATCTGTGG + Exonic
951378769 3:21956886-21956908 ACCTTCAAGTTTATCATCTGTGG + Intronic
953610945 3:44446636-44446658 CCCTTCAAATGCAGCAAGTGTGG - Exonic
953773765 3:45798570-45798592 CACTGCAAGTGCCACCTCTGGGG + Intergenic
958801433 3:98760738-98760760 ACATTCAAGTGCAACTTCTTGGG - Intronic
962310918 3:134326279-134326301 CCCTTCCGGTGCCACCTCTGTGG - Intergenic
965498067 3:169422779-169422801 CCCTTTAAATCCAACTTCTGTGG + Intronic
966489058 3:180505986-180506008 CCCTTCATGTGTAATTTCTGTGG - Intergenic
966985352 3:185175104-185175126 CCCATCAAGTTCATCATCTGTGG - Intergenic
967139047 3:186538075-186538097 CCCCTCAACTGGAACATCAGAGG + Intergenic
970178331 4:13361962-13361984 CCCTTCAATTGCCCCTTCTGAGG - Intronic
970564512 4:17318580-17318602 CCCTCCACGTGCCACAACTGGGG - Intergenic
977136386 4:93310031-93310053 CCCTTCTAGTGGAATATCAGGGG - Intronic
981079130 4:140621617-140621639 CCTTTGAAGGGGAACATCTGTGG + Exonic
982394854 4:154905270-154905292 CACTCCAAGTGCTACAGCTGTGG - Intergenic
984762628 4:183376371-183376393 CCCTCCAAGTGGACCCTCTGGGG + Intergenic
985403349 4:189613576-189613598 CCCTTCAAGTACACCATTTTGGG + Intergenic
986778095 5:11038051-11038073 CCCTTTAAATGTAACATCTCTGG - Intronic
988085498 5:26470179-26470201 CTCTTCAAGTGCATTTTCTGGGG + Intergenic
992520026 5:77540956-77540978 CCCTACCAGTACAAAATCTGAGG + Intronic
993566909 5:89487924-89487946 CCCTTCAAGAGAATCTTCTGTGG + Intergenic
997981079 5:138467632-138467654 CCCTTCGCCTGCGACATCTGTGG + Exonic
1000507475 5:162139306-162139328 CCCTTAAAGTGCGGCATCAGTGG - Intronic
1005675602 6:28151715-28151737 CACTTCATGTGCAAAATCTTTGG + Intronic
1006815018 6:36844276-36844298 TCCTCCAACGGCAACATCTGTGG - Intergenic
1011360347 6:86517394-86517416 CCCTCCATGTGCAACATCCTGGG + Intergenic
1011390662 6:86848997-86849019 AACATCAAGTTCAACATCTGTGG + Intergenic
1013754977 6:113450925-113450947 CACTTCAGGTGCAAAATTTGAGG + Intergenic
1017224013 6:151998935-151998957 CCCTTTTTGTACAACATCTGTGG - Intronic
1018478518 6:164167231-164167253 CCCTTCAAGTCCCAAGTCTGAGG - Intergenic
1024531917 7:50400532-50400554 CCTTTTGAGTGCAACATGTGCGG + Exonic
1027703391 7:81497568-81497590 CCATTCTAGTGGAATATCTGGGG + Intergenic
1029014419 7:97300366-97300388 CCCTTCAAATGGCACAGCTGAGG - Intergenic
1029294802 7:99531623-99531645 CCCTTCAAGTGTAACGAATGTGG + Exonic
1030389035 7:108902690-108902712 CCATTGAAGTGCAAAATCTCTGG + Intergenic
1033448256 7:141440376-141440398 CCATCCAAGTGGAACTTCTGGGG + Intronic
1034224887 7:149474604-149474626 CCCTTCACCTGCACCGTCTGCGG - Exonic
1037355664 8:18017097-18017119 CCCTTTAAGAGCTACTTCTGTGG + Intronic
1037855765 8:22369525-22369547 CCCTTCCAGTGCAAACTCTTGGG + Intronic
1039297467 8:36171887-36171909 CCCTTCAAGTGAAACACGTTTGG - Intergenic
1040080183 8:43276615-43276637 GCCTTCAAGTGCATTCTCTGGGG - Intergenic
1042558274 8:70052225-70052247 CCCTTCAAATGCAAGTACTGTGG - Exonic
1049071445 8:140358824-140358846 CCCGTCAAGGACAACTTCTGGGG - Intronic
1054992875 9:71350600-71350622 CACTTCATGTGAAATATCTGAGG - Intronic
1057181804 9:93034649-93034671 CCCTGCAGGTGCAGCACCTGGGG - Exonic
1060357045 9:122918940-122918962 CCTTTCCAGTGTAAAATCTGTGG - Exonic
1060889298 9:127177967-127177989 CTCTTCATGTGAACCATCTGGGG - Intronic
1187804655 X:23106080-23106102 CCCTACAACTGGAATATCTGAGG + Intergenic
1190362970 X:49666571-49666593 CCTTTTAAGTGTAAGATCTGTGG - Intergenic
1190363106 X:49667342-49667364 GCGTTCAAGTACAACATCTGTGG - Intergenic
1190407564 X:50102915-50102937 CCCTTCAAGTCCAATGTTTGCGG + Intergenic
1190850783 X:54239070-54239092 CCCTGGAAGTGAAGCATCTGAGG + Exonic
1193139031 X:78006239-78006261 TCCTACAAGTGGAACTTCTGAGG - Intronic
1194946843 X:100079025-100079047 CCTTTCAAATGTAAAATCTGTGG + Intergenic
1195881715 X:109599978-109600000 CCCTTCCTATACAACATCTGGGG - Intergenic