ID: 1160454970

View in Genome Browser
Species Human (GRCh38)
Location 18:78993549-78993571
Sequence CCCACGGACGTGGGCACGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160454970_1160454981 13 Left 1160454970 18:78993549-78993571 CCCACCGTGCCCACGTCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1160454981 18:78993585-78993607 CCCACTGTCCCTGGCGCGCACGG 0: 1
1: 0
2: 2
3: 8
4: 151
1160454970_1160454978 4 Left 1160454970 18:78993549-78993571 CCCACCGTGCCCACGTCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1160454978 18:78993576-78993598 CAACTGCCGCCCACTGTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160454970 Original CRISPR CCCACGGACGTGGGCACGGT GGG (reversed) Exonic
900638581 1:3677328-3677350 CCCACTGCTGTGGGCACTGTAGG + Intronic
900796858 1:4713153-4713175 CCCATGGACGGGGGCATGGACGG + Intronic
900992509 1:6104449-6104471 CCTCCGGAGGTGGGCAGGGTAGG + Exonic
906608980 1:47189327-47189349 CCCTGGGAGGTGGGCAGGGTGGG + Intronic
907527803 1:55063878-55063900 CCCACGGACATCGGCACATTGGG - Exonic
922572384 1:226641866-226641888 CCCCCTGAGGTGGGCACGGGTGG + Intronic
922988300 1:229883906-229883928 CCCAGGGAGCTGGGCACAGTGGG + Intergenic
1063115441 10:3068599-3068621 CCCACGGACGCGGGCGCGCCGGG + Intronic
1063199731 10:3776288-3776310 CCCCCGGCTGTGGGCACAGTAGG - Exonic
1070558428 10:77547527-77547549 CACACAGAGGTGGGCCCGGTTGG - Intronic
1076563621 10:131383298-131383320 CCCAGGCACGTGGGGATGGTTGG - Intergenic
1076783422 10:132736933-132736955 CCCTCAGCCGTGGGCACAGTGGG + Intronic
1078432280 11:11297493-11297515 CCCAGGGAGGTGGGCAAGGGAGG - Intronic
1088803148 11:113325632-113325654 CTCACTGACCTGGGCTCGGTTGG - Exonic
1103122145 12:118389239-118389261 CCCACGGGCTGGGGCAGGGTAGG - Intronic
1113885965 13:113658532-113658554 CCCAAGGTCGTGGACACAGTGGG - Intergenic
1122334678 14:100963686-100963708 CCCACGGACCAGGGCAGGGAGGG - Intergenic
1122429417 14:101630438-101630460 CCCAGGGATGGGGGCACGGCTGG - Intergenic
1122767630 14:104082788-104082810 CCCACTGACCTGGGCACTGTGGG + Intergenic
1132996381 16:2825654-2825676 GCCACGGAGGTGGACAGGGTCGG + Intronic
1136399930 16:30011598-30011620 CCTACGGACGTGGGGAAGGGAGG - Intronic
1139415098 16:66801604-66801626 CCCACGGACGTGAGCCTGGTCGG - Exonic
1142341669 16:89527243-89527265 CCAACGGACTTGCACACGGTTGG - Intronic
1142482421 17:227215-227237 CCCAGAGAAGTGGGCACGGCTGG - Intronic
1151673956 17:75588613-75588635 CCTACGGACATGGGCTCGGAAGG + Intergenic
1158530446 18:58255935-58255957 GCCACGGACGGGGCCACGGACGG + Intronic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160506894 18:79432364-79432386 CACACGGAGGTGAGGACGGTCGG + Intronic
1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG + Intronic
1162562741 19:11426868-11426890 CACACGGAGGTGGCCAAGGTAGG - Exonic
1163555942 19:17992958-17992980 CCCCGGGAGGTGGGCAGGGTTGG + Intronic
938766364 2:134462837-134462859 CCCATGGTCATGGGCAGGGTGGG + Intronic
947539327 2:230964326-230964348 CCCACGGAGGTGGGGAGGCTCGG + Intergenic
1175805968 20:61829702-61829724 CCCACGGGCGTCGGCACAGAGGG - Intronic
1176293216 21:5057172-5057194 CCCACGGACGGGCGGGCGGTGGG + Intergenic
1176418982 21:6499219-6499241 CCCGCGGGCGTCGGCAGGGTCGG - Intergenic
1176424633 21:6540639-6540661 CACAGGGACGTGCGCACGGCTGG - Intergenic
1178910340 21:36668836-36668858 GCCGAGGAGGTGGGCACGGTGGG - Intergenic
1179700122 21:43148948-43148970 CACAGGGACGTGCGCACGGCTGG - Intergenic
1179864044 21:44206478-44206500 CCCACGGACGGGCGGGCGGTGGG - Intergenic
950590741 3:13934484-13934506 CCCAAGGACGGGGGCAGTGTGGG + Intergenic
950711931 3:14819303-14819325 CCCAAGGACGAGGGCAGTGTGGG + Exonic
954672868 3:52299856-52299878 CCCAGGGAGGAGGGCAGGGTAGG + Intergenic
968909853 4:3472165-3472187 CCCGGGGAGGTGGGCACGGCTGG + Intronic
968984281 4:3866745-3866767 ACCACGGACGTGGACACAGGAGG + Intergenic
970617438 4:17781344-17781366 CGCACGCACGTGCACACGGTGGG - Exonic
997647171 5:135489287-135489309 CCCTCGGACTTGGGGAGGGTAGG + Intergenic
1006180361 6:32150459-32150481 CCCACGCACGCGGGGACTGTGGG - Exonic
1006924386 6:37646454-37646476 CCCTGGGAGGTGGGCACGGAAGG - Intronic
1019597977 7:1867171-1867193 GCCACAGACATGGGCACCGTAGG + Intronic
1032052737 7:128658862-128658884 CCCACGGAAGTGGGGATGGAAGG + Intergenic
1033275609 7:139969624-139969646 CCCAGGGAGGAGGGCATGGTTGG + Intronic
1035272362 7:157728003-157728025 CCCACAGACGTCTGCAGGGTGGG - Intronic
1038369348 8:26972572-26972594 CACACGGCCGTAGGCAAGGTGGG + Intergenic
1045252956 8:100496566-100496588 CCCAAGGCCATGGCCACGGTGGG - Intergenic
1062536426 9:137023061-137023083 CCCACGGGAGAGGGCAGGGTCGG + Intronic
1186410230 X:9340383-9340405 CCCAGGGAAGTGGGCGGGGTGGG - Intergenic
1192146535 X:68686486-68686508 GCCACGGACGTGGACTCCGTGGG + Intronic
1193951742 X:87808783-87808805 CCCACGGACGTGGAGAGGGGAGG + Intergenic