ID: 1160454978

View in Genome Browser
Species Human (GRCh38)
Location 18:78993576-78993598
Sequence CAACTGCCGCCCACTGTCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 144}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160454972_1160454978 3 Left 1160454972 18:78993550-78993572 CCACCGTGCCCACGTCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1160454978 18:78993576-78993598 CAACTGCCGCCCACTGTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 144
1160454976_1160454978 -6 Left 1160454976 18:78993559-78993581 CCACGTCCGTGGGGCTGCAACTG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1160454978 18:78993576-78993598 CAACTGCCGCCCACTGTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 144
1160454975_1160454978 -5 Left 1160454975 18:78993558-78993580 CCCACGTCCGTGGGGCTGCAACT 0: 1
1: 0
2: 0
3: 5
4: 46
Right 1160454978 18:78993576-78993598 CAACTGCCGCCCACTGTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 144
1160454968_1160454978 12 Left 1160454968 18:78993541-78993563 CCGTGCTGCCCACCGTGCCCACG 0: 1
1: 0
2: 3
3: 22
4: 277
Right 1160454978 18:78993576-78993598 CAACTGCCGCCCACTGTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 144
1160454974_1160454978 0 Left 1160454974 18:78993553-78993575 CCGTGCCCACGTCCGTGGGGCTG 0: 1
1: 0
2: 0
3: 22
4: 143
Right 1160454978 18:78993576-78993598 CAACTGCCGCCCACTGTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 144
1160454970_1160454978 4 Left 1160454970 18:78993549-78993571 CCCACCGTGCCCACGTCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1160454978 18:78993576-78993598 CAACTGCCGCCCACTGTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 144
1160454967_1160454978 13 Left 1160454967 18:78993540-78993562 CCCGTGCTGCCCACCGTGCCCAC 0: 1
1: 0
2: 1
3: 22
4: 293
Right 1160454978 18:78993576-78993598 CAACTGCCGCCCACTGTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 144
1160454966_1160454978 30 Left 1160454966 18:78993523-78993545 CCTGGCTGGACAGCAAGCCCGTG 0: 1
1: 0
2: 0
3: 19
4: 437
Right 1160454978 18:78993576-78993598 CAACTGCCGCCCACTGTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160454978 Original CRISPR CAACTGCCGCCCACTGTCCC TGG Exonic
902554184 1:17237310-17237332 CATCTGCCGCCCACCGGACCTGG - Exonic
903156143 1:21445090-21445112 CCACTGACTCCCACTGTCCAGGG + Exonic
904094082 1:27964274-27964296 CAGGTGTCGCCCACTGTGCCTGG + Intronic
906148233 1:43572531-43572553 CAACTGAGGCCAACGGTCCCAGG - Intronic
906950810 1:50333377-50333399 CAGCTCCCGTCCACTGTCCTTGG - Intergenic
915225432 1:154407742-154407764 CAGCTGCCGCCCACACACCCTGG + Intronic
915321170 1:155057212-155057234 CAACTGCAGCCGACGGGCCCTGG + Exonic
917034223 1:170729352-170729374 AAACTGTCGCTCACTGTCTCTGG - Intronic
919782666 1:201230911-201230933 CAACTGCTTTCCACTGTCCCAGG - Intergenic
920087701 1:203429737-203429759 CAAGTGCCTGCCACTGTGCCCGG - Intergenic
920119543 1:203645731-203645753 CAAGTGCCTGCCACTGTGCCCGG + Intronic
920575906 1:207060072-207060094 CTGCTGCCAGCCACTGTCCCGGG - Intronic
922228810 1:223668063-223668085 CAATGGCTGCCCACTGTTCCTGG + Intergenic
922721643 1:227902930-227902952 CCACTGCCCCACACTGTCTCGGG - Intergenic
922737828 1:227998876-227998898 AAGCTGGGGCCCACTGTCCCTGG - Intergenic
923556839 1:235007704-235007726 CAAATGTTTCCCACTGTCCCTGG - Intergenic
1063089504 10:2849770-2849792 CAATTGCCCCCCAGTGTCCCGGG - Intergenic
1063270938 10:4509491-4509513 CACCTTCCGCCCTGTGTCCCAGG - Intergenic
1069576718 10:69535896-69535918 CAACTCTCTCCCACTGTCCCAGG + Intergenic
1069777881 10:70937385-70937407 CAGCTGCCGCCCACTCCCCTTGG - Intergenic
1074290188 10:112132531-112132553 CAGCAGCTGCCCACAGTCCCTGG + Intergenic
1075170145 10:120105720-120105742 CAAATGGGGCCCACTGTCTCAGG - Intergenic
1076493424 10:130879726-130879748 CAACTGCCATCCACTGTCATGGG - Intergenic
1083893747 11:65610054-65610076 CAACCTCTGCCCACTGCCCCTGG + Intronic
1084460516 11:69294283-69294305 CATCTCCCGCCCTCTGTCCAAGG - Exonic
1085297886 11:75441186-75441208 CAACTCCCACGCCCTGTCCCAGG - Exonic
1089356022 11:117854383-117854405 GAACTGCTGCCCATTGTCCCTGG - Intronic
1093534177 12:20202936-20202958 CACTTGCCTCCCACTGGCCCTGG + Intergenic
1096029070 12:48395645-48395667 CAAATGCCGGACACTGTACCAGG + Intergenic
1099202096 12:79689984-79690006 CACCTGCCGTCCCCGGTCCCGGG - Exonic
1103208113 12:119146105-119146127 CATCTGCCCATCACTGTCCCAGG + Intronic
1104402610 12:128489095-128489117 CACCTGCCGCCCACTGCCCGGGG - Intronic
1105541550 13:21320887-21320909 CTACTACCGCCCACTGCCCGTGG - Intergenic
1105913686 13:24893899-24893921 CATCACCCTCCCACTGTCCCCGG - Intronic
1106177975 13:27347508-27347530 CAAATGCCGCCCACCCTCCTTGG - Intergenic
1106412395 13:29519613-29519635 CCACTGCCGCCCACCATCCAGGG + Intronic
1107114217 13:36729235-36729257 CAGCTTCCTCCCACTTTCCCTGG + Intergenic
1107664229 13:42672646-42672668 CACCTGCCCCCCTCTGTCCCTGG - Intergenic
1108313506 13:49217920-49217942 CAAGTACCACCAACTGTCCCAGG + Intergenic
1109722705 13:66295831-66295853 CAACTGCTGCCCCCTGCCCCGGG - Intergenic
1112794068 13:103035509-103035531 TAAATGACCCCCACTGTCCCAGG - Intergenic
1115784950 14:36815156-36815178 CCACAGCCGCCAACTGGCCCTGG - Intronic
1121595878 14:95161836-95161858 CAACTGCCCCACTCTGTCCCTGG - Intergenic
1122981749 14:105195262-105195284 CACCTGGGGCCCACTGTGCCTGG + Intergenic
1123053563 14:105559218-105559240 CAGCCTCCGGCCACTGTCCCTGG - Intergenic
1123078141 14:105679633-105679655 CAGCCTCCGGCCACTGTCCCTGG - Intergenic
1125600962 15:40915630-40915652 CAACCCCCGCCCCCTGCCCCTGG + Intergenic
1127395547 15:58541541-58541563 CAACACCCACCCACTGCCCCAGG - Intronic
1129392743 15:75228769-75228791 GAGCTGCCTCCCTCTGTCCCAGG + Intergenic
1129665966 15:77579560-77579582 CATCTGCCCCTCCCTGTCCCAGG - Intergenic
1130360344 15:83179158-83179180 AACCTGCCTCCCACTGCCCCTGG + Intronic
1131133359 15:89913741-89913763 TAAATGCCGCCCCCTCTCCCGGG - Intergenic
1131559147 15:93424360-93424382 CAGCTGCGGCACACTGGCCCAGG - Intergenic
1132234640 15:100210089-100210111 CAACAGGCGCCCACTATGCCCGG - Intronic
1132403566 15:101528724-101528746 CAGCTGCGTCCCACAGTCCCAGG + Intergenic
1132410932 15:101577888-101577910 CAAATGGCGTCCTCTGTCCCTGG - Intergenic
1132863116 16:2081231-2081253 CAAAGGCCTCCCTCTGTCCCTGG - Intronic
1133162669 16:3922365-3922387 CCCCTGCCACGCACTGTCCCGGG + Intergenic
1137765673 16:50975841-50975863 CCACTGCTGTCTACTGTCCCTGG - Intergenic
1139594798 16:67951331-67951353 CAGCTGCCCCCCACTACCCCAGG + Intronic
1141126021 16:81401704-81401726 CAGCTGCCGCCCACTGTCCTGGG + Intergenic
1143679593 17:8466685-8466707 CAACTGCCGCACACTGGCCACGG - Intronic
1145294185 17:21575026-21575048 CACCTGCCTCCCTCTGTTCCTGG + Intergenic
1145369649 17:22298160-22298182 CACCTGCCTCCCTCTGTTCCTGG - Intergenic
1145770318 17:27488048-27488070 CCACTGCCTCCCAGTGTCCCTGG + Intronic
1146482590 17:33216925-33216947 CAACTGCCTCCCTCTCTCCATGG - Intronic
1152618428 17:81348558-81348580 CATCCCCCTCCCACTGTCCCAGG - Intergenic
1152809263 17:82373932-82373954 CCACTGCCGACCTCTGCCCCAGG + Intergenic
1152931669 17:83113270-83113292 CTACAGCCCCCCATTGTCCCTGG - Intergenic
1153559442 18:6356959-6356981 CCACAGCTGCCCACTGTCACTGG + Intronic
1153867882 18:9289736-9289758 CAGCTGCAGCCAACTGTACCAGG - Intergenic
1155086335 18:22462899-22462921 CAACAGCTGCCCATTGTCACTGG - Intergenic
1160326141 18:77950602-77950624 CACTTGCCTCCCCCTGTCCCTGG - Intergenic
1160454978 18:78993576-78993598 CAACTGCCGCCCACTGTCCCTGG + Exonic
1161361505 19:3852537-3852559 CCACTGCAGCCAACTGTCCAAGG + Intronic
1162984349 19:14259853-14259875 CAACATCTGCCCAGTGTCCCAGG + Intergenic
1163840188 19:19603110-19603132 CCACTGTCGCCCACTGACCCAGG + Intronic
1166352078 19:42203995-42204017 CACCTGCCCCCCACCCTCCCAGG - Intronic
1167933335 19:52886275-52886297 CAGCTGCCCACCACTGTGCCTGG + Intronic
1167933814 19:52890432-52890454 CCTCTGCTGCCCACTGCCCCAGG + Intronic
1167988905 19:53341109-53341131 CCTCTGCTGCCCACTGTACCAGG - Intronic
926238722 2:11069041-11069063 TGACTGCCGCCTACTGTGCCTGG - Intergenic
927473929 2:23397580-23397602 CAACTGCCTCCCATTTTCCTGGG - Intronic
927926353 2:27016525-27016547 CAAGTGCCCGCCACTGTGCCCGG + Intronic
928269607 2:29844325-29844347 CACCTGCTCCCCACTGGCCCCGG - Intronic
930810629 2:55536694-55536716 CACCTGCCTGCCACTGTGCCTGG + Intronic
937455952 2:122041780-122041802 CAACTGCGCCACACTGTACCAGG + Intergenic
938137231 2:128769565-128769587 CACCTGCCCCGCACTGCCCCAGG - Intergenic
941174196 2:162177104-162177126 CAACAGCCACCCACTCTGCCTGG - Intronic
948246728 2:236492533-236492555 CAACTGCAGGCCAGGGTCCCAGG - Intronic
1168955122 20:1829208-1829230 CAGGTGCAGCCCACTGCCCCTGG - Intergenic
1169486451 20:6038289-6038311 CTATTGCTGCCCATTGTCCCTGG + Exonic
1170910659 20:20564110-20564132 CAACAGCTCCCCACTGTCCATGG + Intronic
1170992287 20:21314490-21314512 GAACTGCCAGCCACTTTCCCAGG + Intronic
1171143863 20:22765096-22765118 CCACTTCCAGCCACTGTCCCTGG + Intergenic
1173896722 20:46556719-46556741 ACACGGCAGCCCACTGTCCCTGG + Intergenic
1175622319 20:60458516-60458538 CTACTGCTGGGCACTGTCCCCGG - Intergenic
1179124152 21:38576804-38576826 CACCTGCCGCCCAACCTCCCTGG + Intronic
1180103172 21:45599430-45599452 CCAGTGCGACCCACTGTCCCAGG + Intergenic
1180112472 21:45668303-45668325 CAACTGTTGTCCACTGTCTCAGG + Intronic
1184296232 22:43527238-43527260 CATCTGCTGCCCACAGGCCCAGG + Intergenic
1184424664 22:44402472-44402494 CCACTCACGCCCACTGCCCCAGG - Intergenic
1184889350 22:47369950-47369972 CAACTGCTGCCTTCTGTCCAGGG + Intergenic
1185296834 22:50058663-50058685 CTCATGCCGCCCTCTGTCCCTGG + Intergenic
953451132 3:43007326-43007348 CCACTGCCCTCAACTGTCCCAGG + Intronic
956836559 3:73100710-73100732 CGCCTGCTGCCCTCTGTCCCAGG + Intergenic
961387566 3:126530961-126530983 TAACTGAAGCCCACTGTCCAGGG - Intronic
961492627 3:127265862-127265884 CAAGTGCCTCTCACTGTGCCTGG - Intergenic
963900989 3:150733436-150733458 CCACTGCCGCCCACCCTGCCAGG - Intergenic
965388189 3:168071517-168071539 AAACTGTCCCCCACTTTCCCCGG + Intronic
966248875 3:177839467-177839489 CGAGTGCCACCCACTGTGCCTGG - Intergenic
969570139 4:8003513-8003535 CAGCTCCCACCCACTGTCTCTGG + Intronic
969859676 4:10025811-10025833 TAACAGCCTCCCACTGACCCAGG + Intronic
977507740 4:97923343-97923365 CAAGTGCCGCCCCCTGCTCCAGG + Intronic
985718887 5:1478595-1478617 GAACTGCCGCCCTCAGGCCCGGG + Intronic
987182714 5:15384779-15384801 TCACTGCCGCGCAGTGTCCCAGG + Intergenic
988705985 5:33726298-33726320 CACCTGCAGCCCTCTGCCCCAGG - Intronic
990200085 5:53362130-53362152 CAGGTGCCCGCCACTGTCCCTGG - Intergenic
990975718 5:61559758-61559780 TATCTGACTCCCACTGTCCCTGG + Intergenic
994926217 5:106120513-106120535 CCTCTGCTGCCCACTGTACCAGG + Intergenic
997781846 5:136667351-136667373 GAAGTGCAGGCCACTGTCCCTGG + Intergenic
998653389 5:144146647-144146669 CAGCTGTGGCCCACTGTGCCCGG + Intergenic
1001516079 5:172356088-172356110 CAACTCCCGCCCACCGTGACTGG + Intronic
1002076380 5:176711011-176711033 CAAATGCTGCCCCCTGTCCTTGG + Intergenic
1005841194 6:29745572-29745594 CTGCTTCTGCCCACTGTCCCCGG + Intergenic
1005870669 6:29972308-29972330 CTGCTTCTGCCCACTGTCCCCGG + Intergenic
1005898582 6:30198348-30198370 CAGCTGCCGCCTACTTGCCCAGG + Intronic
1006059625 6:31410676-31410698 CATCTTCTGCCCACTGTCCCTGG - Exonic
1006072114 6:31505750-31505772 CATTTTCTGCCCACTGTCCCTGG - Exonic
1006686083 6:35835325-35835347 CCACTGCCGCCGAGTGTCTCCGG - Exonic
1007410255 6:41657308-41657330 CAACTGCTGCACACAATCCCAGG + Intergenic
1011601634 6:89065236-89065258 CAAATGCCGCCCCCTGCTCCAGG + Intergenic
1013284716 6:108671330-108671352 CCACTTCAGCACACTGTCCCTGG + Intronic
1013635078 6:112021393-112021415 GAACTGCAGGCCACTGTCCTGGG + Intergenic
1014752189 6:125268682-125268704 CAAATGCCCCCCAATATCCCAGG + Intronic
1019405842 7:883702-883724 CAGCTGCCCCCCACTCTCCCCGG + Intronic
1019990036 7:4683794-4683816 CAACACCCTCCCACTGTCCTGGG - Intronic
1020691812 7:11364709-11364731 CAACTTCCTCCAACTATCCCTGG + Intergenic
1027421308 7:78020041-78020063 CAGCTGCCTGCCCCTGTCCCCGG - Intronic
1031361858 7:120857491-120857513 CGCCCCCCGCCCACTGTCCCAGG - Intronic
1035182221 7:157097702-157097724 CACCTGCCACCGCCTGTCCCTGG - Intergenic
1035322566 7:158042769-158042791 CATCTGCTGCCCACTGTGCCAGG + Intronic
1035743970 8:1948187-1948209 CCCCTGGCGCCCACTCTCCCGGG + Intronic
1037842714 8:22256594-22256616 CCACTGCCATCCACTGTCCAGGG - Intergenic
1038154217 8:24972493-24972515 CAGCTGCACCCCAATGTCCCAGG + Intergenic
1039839314 8:41282120-41282142 CATCTGCCTCTCACTGTCCCTGG + Intronic
1045179737 8:99767649-99767671 CAACTGCGAGCCACTGTGCCCGG - Intronic
1045366421 8:101480253-101480275 CAATTGCCTCCCTCTGTCCCAGG + Intergenic
1047516108 8:125556325-125556347 AAAGTGCCACCCACTGTCCAGGG + Intergenic
1048402043 8:134081294-134081316 CATCTGCCTCCCACTGCTCCTGG + Intergenic
1048852661 8:138659585-138659607 CAGCTGCCTCCCACTCTCTCAGG + Intronic
1053453766 9:38214870-38214892 CAACTCACTCCCACTGTCCCAGG + Intergenic
1057904773 9:98975096-98975118 CCGCTGCCGCGCACGGTCCCGGG + Intronic
1060495370 9:124114666-124114688 CAACTGCCCCCCACCCACCCAGG + Intergenic
1061028631 9:128066761-128066783 CCACTGCCACCGCCTGTCCCAGG + Exonic
1061664882 9:132154827-132154849 CCTCTGCCTCCCACTGCCCCGGG - Intergenic
1061910296 9:133718900-133718922 CAACTCCCTCCCATTATCCCAGG + Intronic
1062606048 9:137349308-137349330 CCCCTCCCGCCCTCTGTCCCGGG - Intronic
1187697047 X:21933303-21933325 CAAGTGGCGCCCCCTGGCCCAGG - Intergenic
1197809620 X:130429723-130429745 CAACTACTTCCCAATGTCCCTGG - Intergenic
1199600328 X:149537903-149537925 CAACGGCCACCCACCATCCCGGG + Intergenic
1199650256 X:149942037-149942059 CAACGGCCACCCACCATCCCGGG - Intergenic
1200075600 X:153549154-153549176 CCACTGCCTCCCAGTGTCCCGGG - Intronic
1200275519 X:154728688-154728710 CAACTGGCTCCAACTTTCCCTGG + Intronic