ID: 1160454981

View in Genome Browser
Species Human (GRCh38)
Location 18:78993585-78993607
Sequence CCCACTGTCCCTGGCGCGCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 151}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160454968_1160454981 21 Left 1160454968 18:78993541-78993563 CCGTGCTGCCCACCGTGCCCACG 0: 1
1: 0
2: 3
3: 22
4: 277
Right 1160454981 18:78993585-78993607 CCCACTGTCCCTGGCGCGCACGG 0: 1
1: 0
2: 2
3: 8
4: 151
1160454977_1160454981 -3 Left 1160454977 18:78993565-78993587 CCGTGGGGCTGCAACTGCCGCCC 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1160454981 18:78993585-78993607 CCCACTGTCCCTGGCGCGCACGG 0: 1
1: 0
2: 2
3: 8
4: 151
1160454976_1160454981 3 Left 1160454976 18:78993559-78993581 CCACGTCCGTGGGGCTGCAACTG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1160454981 18:78993585-78993607 CCCACTGTCCCTGGCGCGCACGG 0: 1
1: 0
2: 2
3: 8
4: 151
1160454975_1160454981 4 Left 1160454975 18:78993558-78993580 CCCACGTCCGTGGGGCTGCAACT 0: 1
1: 0
2: 0
3: 5
4: 46
Right 1160454981 18:78993585-78993607 CCCACTGTCCCTGGCGCGCACGG 0: 1
1: 0
2: 2
3: 8
4: 151
1160454970_1160454981 13 Left 1160454970 18:78993549-78993571 CCCACCGTGCCCACGTCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1160454981 18:78993585-78993607 CCCACTGTCCCTGGCGCGCACGG 0: 1
1: 0
2: 2
3: 8
4: 151
1160454972_1160454981 12 Left 1160454972 18:78993550-78993572 CCACCGTGCCCACGTCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1160454981 18:78993585-78993607 CCCACTGTCCCTGGCGCGCACGG 0: 1
1: 0
2: 2
3: 8
4: 151
1160454967_1160454981 22 Left 1160454967 18:78993540-78993562 CCCGTGCTGCCCACCGTGCCCAC 0: 1
1: 0
2: 1
3: 22
4: 293
Right 1160454981 18:78993585-78993607 CCCACTGTCCCTGGCGCGCACGG 0: 1
1: 0
2: 2
3: 8
4: 151
1160454974_1160454981 9 Left 1160454974 18:78993553-78993575 CCGTGCCCACGTCCGTGGGGCTG 0: 1
1: 0
2: 0
3: 22
4: 143
Right 1160454981 18:78993585-78993607 CCCACTGTCCCTGGCGCGCACGG 0: 1
1: 0
2: 2
3: 8
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160454981 Original CRISPR CCCACTGTCCCTGGCGCGCA CGG Exonic
900242267 1:1622783-1622805 TGCACTGTCCCTGACGTGCAGGG + Intronic
900356956 1:2269682-2269704 CCCACTGTCCCTGGTGCCCAAGG - Intronic
901053947 1:6440145-6440167 CCCACTCTCCCTGCCGTCCAGGG + Intronic
901843340 1:11966870-11966892 CCCAGTGTCCCCGGGGAGCAGGG - Intronic
902308392 1:15561396-15561418 GCCACTGTTCCTGGCCGGCAGGG - Intronic
902480347 1:16708165-16708187 CCCACTCTCCCTGCCGTCCAGGG - Intergenic
904404128 1:30275095-30275117 CCCACTGTTCCTGGCAGGCTTGG - Intergenic
904528735 1:31154837-31154859 CCCACTGTCTCTGGAGACCAAGG - Intergenic
906980283 1:50621877-50621899 GCCACTGTGCCTGGCCAGCAGGG - Intronic
907307872 1:53523600-53523622 CACACCCTCCCTGGCGCTCAAGG + Intronic
907472792 1:54685305-54685327 GCCACTGTGCCTGGCCTGCATGG + Intronic
908490892 1:64643149-64643171 CCCACTGTCCCTGAACCACATGG - Intronic
918873541 1:190008632-190008654 GCCACTGTACCTGGCGAGGAAGG + Intergenic
924293405 1:242561474-242561496 GCCACTGTGCCTGGCCCACAAGG - Intergenic
1066072891 10:31838541-31838563 GCCACTGTGCCTGGCCCGCTTGG - Intronic
1067878107 10:50021793-50021815 CCCACTGCCCCTGCAGCTCAGGG - Intergenic
1069396886 10:67999015-67999037 GCCACTGTGCCTGGCTCCCATGG + Intronic
1071096480 10:81981436-81981458 CCCAGTGGGCCTGGAGCGCAGGG - Intronic
1072751769 10:97985905-97985927 CTCAGTGTCCCTGGCCAGCAAGG + Intronic
1073563995 10:104519814-104519836 CCCACTGGCCCTGCCCCACATGG - Intergenic
1074503584 10:114046227-114046249 CCCGCTGTCCCCCGCGCGCCTGG + Exonic
1074976799 10:118587578-118587600 CCCTCTGTCCCTGGAGGGCGAGG - Intergenic
1075462138 10:122623949-122623971 CCCACTGTCCCTGTAGCTCATGG + Intronic
1077386180 11:2270523-2270545 CCCACGCTCCCTGGCGCGTACGG - Exonic
1077532351 11:3103210-3103232 CCCACCCTCCCTGGCTGGCAGGG + Intronic
1079735633 11:23993985-23994007 CCCACTGTCCTTGGACCCCAGGG + Intergenic
1079773952 11:24499532-24499554 CCCACTGTCCCAGGTGGCCATGG - Intronic
1079954032 11:26840652-26840674 CCCACTGTCACTGGCCCTTAGGG + Intergenic
1082890464 11:58133430-58133452 CCCACTCCCTCTGGCGCTCAGGG + Intronic
1083138538 11:60702683-60702705 GCCACTGTGCCTGGCCCACATGG + Intronic
1083842954 11:65315130-65315152 CCCACGGACCGTGGCGGGCACGG - Intronic
1084544420 11:69807604-69807626 GCCACTGTCCCTGGAGCCCCTGG + Intergenic
1084726167 11:70943560-70943582 GCCCCTGTCCCTGCCGCCCAGGG - Intronic
1088197081 11:107286667-107286689 GCCACTGTGCCTGGCCCGTATGG - Intergenic
1089408939 11:118222127-118222149 GCCACTGTGCCTGGCCAGCAGGG - Intronic
1096113563 12:49042321-49042343 CCCGCGCTCCCTGGGGCGCAGGG + Exonic
1096866435 12:54566441-54566463 CCCTCTGTGCCTGGCAGGCATGG - Intronic
1104981170 12:132573706-132573728 CCCCCTTTCCCTGGCGCCCCTGG + Intronic
1106828051 13:33545379-33545401 GCCACTGTGCCTGGCCCGAAAGG + Intergenic
1109703785 13:66062081-66062103 CTCAATTTTCCTGGCGCGCAAGG - Intergenic
1110862028 13:80355207-80355229 GCCACTGTGCCTGGCGACCATGG - Intergenic
1121118095 14:91357764-91357786 CCCCCGGTCCCTGGAGCCCAGGG + Intronic
1122161074 14:99784377-99784399 GCCACTGTGCCTGGCCTGCAAGG + Intronic
1122871411 14:104640684-104640706 CCCCCCATCCCTGGTGCGCACGG + Intergenic
1123053559 14:105559209-105559231 GCCACTGTCCCTGGAGGACAAGG - Intergenic
1123078137 14:105679624-105679646 GCCACTGTCCCTGGAGGACAAGG - Intergenic
1202922958 14_KI270724v1_random:2328-2350 CCCTCGCTCCCTGGCTCGCAGGG + Intergenic
1125001386 15:34773987-34774009 CCCACTGTACCTGGGAAGCATGG - Intergenic
1127292386 15:57582022-57582044 CCCATTGTCCCTGTCAGGCAGGG - Intergenic
1128221318 15:65970649-65970671 CCAAATGTCCCTGGTGGGCAGGG + Exonic
1129272376 15:74425984-74426006 CCCACTGTGCCTGGCCTCCATGG - Intronic
1129696354 15:77742566-77742588 CCCTCTGTCTCTGGCTCTCATGG - Intronic
1130836490 15:87654899-87654921 CCCCCTGTCCCTGTAGAGCATGG + Intergenic
1132282300 15:100630623-100630645 ACCACTGTCCCTGGACCACATGG + Intronic
1132406410 15:101544038-101544060 CCCCCTGCCCCGCGCGCGCAGGG + Intergenic
1134260433 16:12646944-12646966 CCCAGTGTCCCTGCCAGGCACGG + Intergenic
1138562139 16:57807676-57807698 GCCACTGTGCCTGGCCGGCAAGG - Intronic
1138979013 16:62243765-62243787 GCCACTGTGCCTGGCCAGCAGGG - Intergenic
1139282667 16:65784049-65784071 CCCACTGACCCAGGCCCTCAGGG + Intergenic
1141714937 16:85721427-85721449 CCAACTGTCCCTGGAGGGCAGGG + Intronic
1145256070 17:21323210-21323232 CCCACTGTCCCGGGAGCGACTGG - Intergenic
1150484910 17:65536982-65537004 CCCTCCTTCCCTGGCGGGCAGGG + Exonic
1151721136 17:75856519-75856541 CCCACTGTACTTGTCCCGCAAGG - Intergenic
1152303996 17:79510784-79510806 TCCACTGTGCCTGGCCAGCAAGG - Intronic
1152414676 17:80151848-80151870 CCCTTTGTCCCTGGCCCCCAAGG + Intergenic
1160409605 18:78666905-78666927 CACACTGTCCCTGGGAGGCAGGG + Intergenic
1160454981 18:78993585-78993607 CCCACTGTCCCTGGCGCGCACGG + Exonic
1160500865 18:79400584-79400606 CCCTCGGTCCCGGGCGCGCCGGG - Intronic
1160817265 19:1041969-1041991 CCCACTGCCTCTGGCTCACAGGG - Exonic
1160843132 19:1155300-1155322 GCCACTGTCTCTGGAGCGCCGGG - Intronic
1163122067 19:15223929-15223951 CCCACTGTCCCGACCGAGCAGGG - Intergenic
1163382206 19:16976556-16976578 CCCACTCTCCTTGGTGGGCAGGG - Intronic
1163453265 19:17391326-17391348 CCCAGAGGCCCTGGCGCGCTGGG - Intergenic
1163699406 19:18779835-18779857 CCCACTGTCCCTGGCAAGCTCGG - Exonic
1164847822 19:31449528-31449550 ACCACTGCCCCTGGCCGGCATGG + Intergenic
1165256150 19:34578210-34578232 TCCCCTGTCCCTGCCCCGCAGGG - Intergenic
1165274060 19:34733230-34733252 TCCCCTGTCCCTGCCCCGCAGGG + Intergenic
1165954737 19:39495261-39495283 GCCACTGTGCCTGGCCAGCATGG + Intergenic
1168543053 19:57228974-57228996 GCCACTGTCCCTGGCCCTCGGGG - Intergenic
1168559503 19:57371236-57371258 GCCACTGTGCCTGGCCCCCATGG + Intronic
1202714386 1_KI270714v1_random:34067-34089 CCCACTCTCCCTGCCGTCCAGGG - Intergenic
924979020 2:203448-203470 CACATTGTCCCTGGCGCTCTGGG - Intergenic
925086183 2:1109091-1109113 CACGCTGTCACTGGGGCGCAGGG + Intronic
925716483 2:6788698-6788720 CCCATTGTACCTGGCCCTCATGG + Intergenic
928575959 2:32655274-32655296 GCCACTGTGCCTGGCCCGCCTGG + Intronic
929649086 2:43659843-43659865 GCCACTGTGCCTGGCCTGCAAGG + Intronic
930121971 2:47767990-47768012 CCCACTGTCCCTGGGCTCCAGGG - Intronic
930736508 2:54785467-54785489 GCCACTGTGCCTGGCCCCCATGG + Intronic
933698552 2:85238015-85238037 CCCACTGACCCTGGCGGCCCAGG - Intronic
933707678 2:85304059-85304081 TCCACTGTGCAGGGCGCGCAGGG - Intronic
949044255 2:241863703-241863725 CCCACTGGCCCGAGCGAGCACGG - Intergenic
1171092180 20:22295751-22295773 CCCTCTTTCCCTGGCCAGCAGGG - Intergenic
1172639898 20:36434615-36434637 CCCACTGTCCCTTGGGAACATGG - Intronic
1173580976 20:44146317-44146339 GCCACTGCCCCTGGCCCACATGG + Intronic
1174664551 20:52245792-52245814 TCCACTGTCTCTGGCTTGCATGG - Intergenic
1178854572 21:36239702-36239724 GCCACGGTGCCTGGCGCACAGGG + Intronic
1179840195 21:44067566-44067588 CCCACAGTGCCTGGCAGGCAAGG - Intronic
1180054815 21:45352222-45352244 GCCACTGTGCCTGGCCCTCATGG - Intergenic
1180103174 21:45599439-45599461 CCCACTGTCCCAGGCCCCCATGG + Intergenic
1182281227 22:29218731-29218753 CCCACTGGCCCAGGCACTCAGGG - Intronic
1184421668 22:44385858-44385880 CCCACTGTTCCTGCAGCGGATGG + Intergenic
1184942786 22:47781321-47781343 CTCCCTGTCCCTGGTGTGCACGG + Intergenic
954762451 3:52886171-52886193 CCCACTGTCCCTGACCTGCTTGG - Intronic
956505062 3:69929183-69929205 ACCACTGTGGCTGGCGTGCATGG - Intronic
961429141 3:126868043-126868065 TCATCTGTCCCTGGAGCGCAAGG + Intronic
964227804 3:154428074-154428096 CCCACTGTGACGAGCGCGCATGG - Intronic
964771243 3:160225971-160225993 GCCGCTGTCCCGGGCGCGCCTGG - Exonic
966404550 3:179582931-179582953 GCCACTGTACCTGGCAGGCATGG - Intronic
968511230 4:996816-996838 CCCACTCTCTCTGGCCAGCAAGG - Intronic
968834544 4:2953946-2953968 GCCACTGCACCTGGCGCGGATGG - Intronic
971915736 4:32867854-32867876 GCCACTGTGCCTGGCCCACAAGG + Intergenic
973981298 4:56310340-56310362 GCCACTTTCCCTGGGGTGCAGGG - Intronic
979828190 4:125266140-125266162 ACCACTGGCCCTGGTGCACATGG - Intergenic
982629863 4:157819117-157819139 TCCAGTGTCCCTGGTGAGCAAGG - Intergenic
994083367 5:95731730-95731752 GCCCCTGTCCCTGGGGCGCACGG - Intronic
995462439 5:112418793-112418815 GCCGCTGTCCCCTGCGCGCAGGG - Intronic
999203700 5:149833594-149833616 CTCACTGTGCCTGGCTCCCAAGG + Exonic
1001944788 5:175770134-175770156 CCAAATGTCCCTGGAGGGCACGG + Intergenic
1003138918 6:3455951-3455973 CCAACTGTGACTGCCGCGCATGG - Exonic
1006335554 6:33418688-33418710 CCCGCTGTCCCTGGGTAGCAGGG + Intergenic
1006467345 6:34203504-34203526 CCCACTGGCCTTGGCGTGCGGGG - Intergenic
1010142009 6:72622626-72622648 ACCACTGTCCCTGGCCCCCTGGG + Intronic
1013419075 6:109949851-109949873 CCCACTGTCCCAGCGCCGCAGGG + Intergenic
1015186772 6:130426191-130426213 GCCACTGTCCCTGGCCCTCAAGG - Intronic
1015895084 6:138009199-138009221 ACCTCTGTCCCTGGAGCTCAAGG + Intergenic
1019206116 6:170363384-170363406 ACCGCTGTCCCTGGTGTGCATGG + Intronic
1019465974 7:1189192-1189214 TCCACTGTCCGTGGCGCACCTGG + Intergenic
1022923286 7:35037244-35037266 GCCCCTGTCCCCGGGGCGCAAGG - Intronic
1023264880 7:38394102-38394124 GCCACTGTCCCTGCCGGGGAAGG - Exonic
1024202734 7:47122818-47122840 CCCACTGTGCCTGCCCCCCAGGG - Intergenic
1029727344 7:102415851-102415873 CCCAGTGTTCCTGGCCCTCACGG + Intronic
1031887166 7:127254124-127254146 CCCGCTCTCCCTGGCTCGCCCGG - Intergenic
1034935425 7:155197036-155197058 CCCACACTCCCTGGCACGCAGGG + Intronic
1035107853 7:156457185-156457207 CCCACTGTCCCTGTCTTGCGTGG - Intergenic
1035107866 7:156457257-156457279 CCCACTGCCCCTGACAGGCATGG + Intergenic
1035108532 7:156461782-156461804 CCCAGTGTCCCTGTCTTGCATGG - Intergenic
1035429294 7:158805999-158806021 CCCTGTGTCCCTGGGGCCCATGG - Intronic
1037929977 8:22873340-22873362 GCCACTGTGCCTGGCCAGCATGG - Intronic
1039543966 8:38394553-38394575 GCCACTGTGCCTGGCCCACAGGG - Intronic
1041712946 8:60910077-60910099 CCGCCTGCCCCGGGCGCGCAGGG - Intergenic
1046913825 8:119658797-119658819 AGCACTGTCCCTGGCACACAGGG + Intronic
1047542708 8:125785694-125785716 CCCACTGTCCTTTCCTCGCAGGG + Intergenic
1049476396 8:142798989-142799011 CTCACTCTCCCTGGAGCCCAGGG - Intergenic
1049717911 8:144102082-144102104 GCCACTGCCCCTGGCTCACATGG - Intronic
1050373384 9:4945731-4945753 CCCACAGGCCCTGGAGCGCTTGG + Intergenic
1052245262 9:26326475-26326497 CCCAATGTCCCTGTCGTCCATGG - Intergenic
1053135974 9:35650497-35650519 CCCACCGTCCCTGCCCCGGATGG + Exonic
1058296536 9:103314945-103314967 GCCACTGCCCCTGGCAAGCAAGG + Intergenic
1060403789 9:123362906-123362928 CACTCGGTCCCTGGAGCGCACGG - Exonic
1061150869 9:128827256-128827278 TCCTCTGTCCCTAGCGCCCATGG + Intronic
1061329776 9:129885253-129885275 CCCACTGTCCCCGTCGGGGATGG - Intergenic
1061680562 9:132240825-132240847 CCCACTCTCCCGGCCTCGCAGGG - Intronic
1061864352 9:133484872-133484894 CCGCCTGTCCCTGGGGAGCATGG + Intergenic
1187075430 X:15929854-15929876 CCCACTGACCCTGGCCCAAATGG - Intergenic
1190998734 X:55637296-55637318 CCCACTGTCCCTGGGGAGCAGGG + Intergenic
1192445220 X:71206125-71206147 GCCACTGTGCCTGGCCCGCCTGG - Intergenic
1195023898 X:100856207-100856229 CCCACAGCCCCTGGAGCGCTTGG + Intronic
1195086809 X:101420909-101420931 GCCACTGTGCCTGGCCCCCAGGG - Intronic
1195625220 X:106999926-106999948 CCCGCCGGCCCTGGCGCGCCGGG - Exonic
1200275943 X:154732710-154732732 CCCACTGACCCTGGGGTGCTGGG - Intronic
1202415691 Y:24619873-24619895 CCCACTGTCCCAGTAGGGCAGGG - Intronic
1202455096 Y:25050213-25050235 CCCACTGTCCCAGTAGGGCAGGG + Intronic