ID: 1160455097

View in Genome Browser
Species Human (GRCh38)
Location 18:78994107-78994129
Sequence CCGTTCAAGTGCAAGATCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 3, 3: 4, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160455095_1160455097 -1 Left 1160455095 18:78994085-78994107 CCGGACGCACACGGGGGAGCGGC 0: 1
1: 0
2: 1
3: 7
4: 69
Right 1160455097 18:78994107-78994129 CCGTTCAAGTGCAAGATCTGCGG 0: 1
1: 0
2: 3
3: 4
4: 86
1160455088_1160455097 23 Left 1160455088 18:78994061-78994083 CCAGAGCGCGCTGAAGATGCACT 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1160455097 18:78994107-78994129 CCGTTCAAGTGCAAGATCTGCGG 0: 1
1: 0
2: 3
3: 4
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160455097 Original CRISPR CCGTTCAAGTGCAAGATCTG CGG Exonic
900031790 1:377993-378015 GGGTTAAAGTGCAAGATTTGGGG + Intergenic
900581353 1:3411461-3411483 CAGATCAAGTGCAAGGACTGTGG + Exonic
906493127 1:46283555-46283577 AAGTTCAAGAGAAAGATCTGGGG + Intronic
907952388 1:59196228-59196250 CCGTGCAAGTGAAATATCTCCGG + Intergenic
911246866 1:95527717-95527739 ATCTACAAGTGCAAGATCTGGGG - Intergenic
1064138015 10:12767032-12767054 CCGCTGAAGGGCAAGATCTCTGG + Intronic
1073463166 10:103678146-103678168 CCGTTCATGTGTAATGTCTGGGG + Intronic
1074780835 10:116800782-116800804 CCATTCAAATGCAAACTCTGAGG + Intergenic
1074879670 10:117645897-117645919 CCAGGCAAGTGCCAGATCTGTGG - Intergenic
1088669975 11:112131421-112131443 CTGTTCCAGGGGAAGATCTGGGG - Intronic
1089627856 11:119762814-119762836 CCTTTCAGAAGCAAGATCTGAGG - Intergenic
1097023236 12:56035242-56035264 CCTTTTGAGTGCAACATCTGTGG + Exonic
1102888030 12:116536266-116536288 CCATTCTAGGGCAACATCTGTGG + Intergenic
1104753856 12:131256709-131256731 CAGTTAAAGTGCAGGTTCTGAGG + Intergenic
1108614844 13:52122220-52122242 CTGTACAAGTGAAAGAGCTGAGG - Intronic
1114692885 14:24601251-24601273 CCACTCAAGTGCACCATCTGGGG - Intergenic
1115080664 14:29446544-29446566 GAGTTCAAGGGCAAGGTCTGTGG - Intergenic
1128467543 15:67925447-67925469 TGGTCCAAGAGCAAGATCTGGGG - Intergenic
1129117228 15:73371184-73371206 CCCATCAAGGGCAAGACCTGGGG - Intergenic
1132897192 16:2234709-2234731 CCGTTCAAGTGCTACAAGTGCGG + Exonic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1136622213 16:31436734-31436756 CCCTGCAAGTGCAAGGCCTGCGG - Exonic
1137786231 16:51140003-51140025 CCCTTTAAGTGTAAGATCTGTGG - Exonic
1137786379 16:51140774-51140796 CCATTCAAGTGCAACATCTGCGG - Exonic
1140686629 16:77439947-77439969 GCATTCAAGTGCAAGTACTGTGG - Intergenic
1140794553 16:78424947-78424969 CCTTTCAAGTGAATCATCTGGGG + Exonic
1142183088 16:88681147-88681169 CCCTGCACCTGCAAGATCTGTGG - Exonic
1146532346 17:33619419-33619441 AGGTGCAAGTGCAACATCTGAGG + Intronic
1152947867 17:83207721-83207743 GGGTTAAAGTGCAAGATTTGGGG - Intergenic
1160214277 18:76913823-76913845 CCCTACAAGTGCAAGCTCTGTGG + Exonic
1160454920 18:78993330-78993352 CCCTTCAAGTGCAACATCTGCGG + Exonic
1160455097 18:78994107-78994129 CCGTTCAAGTGCAAGATCTGCGG + Exonic
1162284402 19:9727419-9727441 CCTTTCAATGGGAAGATCTGGGG - Intergenic
1164821293 19:31253262-31253284 CAGTTCAAGTACAAGAGCTAAGG + Intergenic
1167406098 19:49309810-49309832 CCGTTCACATTCAGGATCTGGGG + Exonic
1168339575 19:55615431-55615453 CCCTACAAGTGCGAGCTCTGCGG + Exonic
937763436 2:125632308-125632330 AAGTTCAAGTGAAAGATCTCAGG - Intergenic
944293919 2:198040558-198040580 CCGTTCTAGAGGAGGATCTGAGG + Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1177033578 21:16013735-16013757 CAGGTCGAGTGCAAGATCAGAGG - Intergenic
952958380 3:38574767-38574789 GGGTTCAAATGCCAGATCTGTGG + Intronic
953406920 3:42664245-42664267 CCGTACATCTGCGAGATCTGTGG + Exonic
955769024 3:62371588-62371610 CCGTTCGTGTGCAAAGTCTGCGG - Exonic
957185550 3:76937255-76937277 CCTTACATGTGCCAGATCTGTGG + Intronic
963086916 3:141445497-141445519 CCATACCAGTGCAAGACCTGCGG + Exonic
964788455 3:160426737-160426759 CTGCTCAAGTGCATGATCAGGGG - Intronic
966443381 3:179973311-179973333 CTGTTCCTGGGCAAGATCTGTGG - Intronic
969759810 4:9173787-9173809 CAGCTCAAGTGCAAAAACTGTGG + Exonic
982693407 4:158572772-158572794 CCGTTACAGTGCAGGAGCTGAGG - Exonic
990004824 5:50934053-50934075 CTGTTCAATTGCAAGTACTGTGG - Intergenic
999147252 5:149404781-149404803 CCGTTCATGTGCATGCCCTGGGG - Intergenic
1002742030 5:181440875-181440897 GGGTTAAAGTGCAAGATTTGGGG - Intergenic
1003890178 6:10557079-10557101 CCGTCCAATTGCATGAGCTGGGG - Intronic
1016314482 6:142771251-142771273 CTGTCCATGTGCATGATCTGTGG + Exonic
1016439410 6:144067966-144067988 ACTTTCAAGTACAAGATCTTTGG + Intergenic
1019247167 6:170716613-170716635 GGGTTAAAGTGCAAGATTTGGGG - Intergenic
1027703391 7:81497568-81497590 CCATTCTAGTGGAATATCTGGGG + Intergenic
1030389035 7:108902690-108902712 CCATTGAAGTGCAAAATCTCTGG + Intergenic
1034353413 7:150432137-150432159 CTGTTGAACTCCAAGATCTGTGG - Intergenic
1035619955 8:1029199-1029221 CGGTTCCAGTGCAGGCTCTGTGG - Intergenic
1036263406 8:7257518-7257540 CAGCTCAAGTGCAAAAACTGCGG + Intergenic
1036264709 8:7265140-7265162 CAGCTCAAGTGCAAAAACTGCGG + Intergenic
1036266008 8:7272762-7272784 CAGCTCAAGTGCAAAAACTGCGG + Intergenic
1036267310 8:7280384-7280406 CAGCTCAAGTGCAAAAACTGCGG + Intergenic
1036268613 8:7288006-7288028 CAGCTCAAGTGCAAAAACTGCGG + Intergenic
1036269917 8:7295628-7295650 CAGCTCAAGTGCAAAAACTGCGG + Intergenic
1036297977 8:7551426-7551448 CAGCTCAAGTGCAAAAACTGCGG - Intergenic
1036299282 8:7559075-7559097 CAGCTCAAGTGCAAAAACTGCGG - Intergenic
1036300587 8:7566724-7566746 CAGCTCAAGTGCAAAAACTGCGG - Intergenic
1036301891 8:7574369-7574391 CAGCTCAAGTGCAAAAACTGCGG - Intergenic
1036303188 8:7582018-7582040 CAGCTCAAGTGCAAAAACTGCGG - Intergenic
1036315450 8:7716057-7716079 CAGCTCAAGTGCAAAAACTGCGG + Intergenic
1036316758 8:7723705-7723727 CAGCTCAAGTGCAAAAACTGCGG + Intergenic
1036318065 8:7731353-7731375 CAGCTCAAGTGCAAAAACTGCGG + Intergenic
1036319372 8:7739001-7739023 CAGCTCAAGTGCAAAAACTGCGG + Intergenic
1036320681 8:7746648-7746670 CAGCTCAAGTGCAAAAACTGCGG + Intergenic
1036321991 8:7754296-7754318 CAGCTCAAGTGCAAAAACTGCGG + Intergenic
1036323300 8:7761944-7761966 CAGCTCAAGTGCAAAAACTGCGG + Intergenic
1036324595 8:7769591-7769613 CAGCTCAAGTGCAAAAACTGCGG + Intergenic
1036351439 8:8014716-8014738 CAGCTCAAGTGCAAAAACTGCGG - Intergenic
1036352745 8:8022362-8022384 CAGCTCAAGTGCAAAAACTGCGG - Intergenic
1036354036 8:8030010-8030032 CAGCTCAAGTGCAAAAACTGCGG - Intergenic
1038618363 8:29116549-29116571 CCTGTCAAGGGCAAGGTCTGTGG - Intronic
1042558274 8:70052225-70052247 CCCTTCAAATGCAAGTACTGTGG - Exonic
1044753674 8:95439941-95439963 ACTTTCCTGTGCAAGATCTGAGG + Intergenic
1048326200 8:133441363-133441385 AAGTTCAAGTTCAAGCTCTGGGG - Intergenic
1050121659 9:2314490-2314512 GAGTCCAAGTCCAAGATCTGAGG - Intergenic
1057037987 9:91825462-91825484 TCTTCCAAGTGCAAGATCTCAGG - Intronic
1060357045 9:122918940-122918962 CCTTTCCAGTGTAAAATCTGTGG - Exonic
1203607941 Un_KI270748v1:72091-72113 GGGTTAAAGTGCAAGATTTGGGG - Intergenic
1190362970 X:49666571-49666593 CCTTTTAAGTGTAAGATCTGTGG - Intergenic
1190363106 X:49667342-49667364 GCGTTCAAGTACAACATCTGTGG - Intergenic
1193070033 X:77297307-77297329 CCTTTCAATGGGAAGATCTGGGG + Intergenic
1194946843 X:100079025-100079047 CCTTTCAAATGTAAAATCTGTGG + Intergenic