ID: 1160455616

View in Genome Browser
Species Human (GRCh38)
Location 18:78996961-78996983
Sequence ATCACCCCCTAGGAGAGCCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160455616_1160455624 23 Left 1160455616 18:78996961-78996983 CCATGGCTCTCCTAGGGGGTGAT 0: 1
1: 0
2: 2
3: 8
4: 111
Right 1160455624 18:78997007-78997029 CCAGAAGGACCTGGCAGCTCGGG 0: 1
1: 0
2: 1
3: 30
4: 237
1160455616_1160455620 8 Left 1160455616 18:78996961-78996983 CCATGGCTCTCCTAGGGGGTGAT 0: 1
1: 0
2: 2
3: 8
4: 111
Right 1160455620 18:78996992-78997014 GTTCTCTGAAATGTTCCAGAAGG 0: 1
1: 0
2: 3
3: 22
4: 214
1160455616_1160455622 22 Left 1160455616 18:78996961-78996983 CCATGGCTCTCCTAGGGGGTGAT 0: 1
1: 0
2: 2
3: 8
4: 111
Right 1160455622 18:78997006-78997028 TCCAGAAGGACCTGGCAGCTCGG 0: 1
1: 0
2: 3
3: 32
4: 239
1160455616_1160455621 14 Left 1160455616 18:78996961-78996983 CCATGGCTCTCCTAGGGGGTGAT 0: 1
1: 0
2: 2
3: 8
4: 111
Right 1160455621 18:78996998-78997020 TGAAATGTTCCAGAAGGACCTGG 0: 1
1: 0
2: 0
3: 22
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160455616 Original CRISPR ATCACCCCCTAGGAGAGCCA TGG (reversed) Exonic
900342034 1:2194094-2194116 ATCACCCCCCAGGAGAAACCAGG + Exonic
901537046 1:9889264-9889286 ATCGCCCCCATTGAGAGCCACGG - Intronic
915282300 1:154830814-154830836 ATCACACAATGGGAGAGCCAGGG - Intronic
919313882 1:195947713-195947735 ATCAGCCAGTAGGAGAGCCTAGG + Intergenic
922138125 1:222852732-222852754 ATTATTCCCCAGGAGAGCCAAGG - Intergenic
1063493473 10:6486277-6486299 ATCACTACCAGGGAGAGCCAGGG - Intronic
1063942471 10:11144601-11144623 AGCACCCCCAAGGACAGGCACGG + Intronic
1067343474 10:45422004-45422026 ATGGCCTCCTAGGAGACCCAGGG + Intronic
1070594247 10:77821273-77821295 ATCACCCCCTCGCAAGGCCAGGG - Exonic
1072634702 10:97170448-97170470 ACCACCTCCTGGCAGAGCCATGG - Intronic
1072675963 10:97466386-97466408 ACCTCCCCTAAGGAGAGCCAAGG + Intronic
1079372623 11:19864578-19864600 TTCCCCACCAAGGAGAGCCAGGG - Intronic
1084610230 11:70197538-70197560 ACTACCCCCAAGGAGAGCCAAGG + Intergenic
1086945277 11:92838667-92838689 ATCACCCCAAAGGAGTCCCAGGG + Intronic
1089339585 11:117748514-117748536 TACACCACCCAGGAGAGCCAGGG - Intronic
1091691323 12:2599340-2599362 ATGTCCCCCTTGGACAGCCACGG - Intronic
1093405435 12:18798600-18798622 AACACCCTCTGGCAGAGCCAGGG + Intergenic
1094367269 12:29697613-29697635 ATCTCGCTCCAGGAGAGCCAGGG + Intronic
1097450674 12:59733810-59733832 AACAACTCTTAGGAGAGCCACGG + Intronic
1102890186 12:116552761-116552783 ATAAGCCCCCAGGAGAGCCCAGG + Intergenic
1107387975 13:39933164-39933186 ATCAGCACCTAGGAGACCTATGG - Intergenic
1110309147 13:74026925-74026947 ATCACCACCTAGAAAAGTCAGGG + Intronic
1112414140 13:99190319-99190341 ATCACCCCCTGGGAACGCCATGG + Intergenic
1116131197 14:40856890-40856912 ATCACCATCTAGGAGCCCCAGGG + Intergenic
1117819162 14:59630528-59630550 GGCGCCCCCGAGGAGAGCCACGG - Intronic
1118441516 14:65816230-65816252 ATCTCCCCCAAGGAAATCCATGG - Intergenic
1119101665 14:71885551-71885573 ATCACATCCTAGGAGAACCACGG - Intergenic
1119207147 14:72802936-72802958 ATCACCCCCATGGAGGTCCAGGG + Intronic
1120967993 14:90184518-90184540 AACGCCCACTATGAGAGCCAAGG + Exonic
1122252512 14:100449825-100449847 ATCACACCATAGCAGAGGCAGGG - Intronic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1131188611 15:90295131-90295153 ATCACCCCATATGGGAGCCAGGG + Exonic
1135168105 16:20158196-20158218 ATCTGCACCTAAGAGAGCCATGG - Intergenic
1136927435 16:34388320-34388342 ATCATCCCCTAGCAGAGCCATGG + Intergenic
1136977139 16:35023486-35023508 ATCATCCCCTAGCAGAGCCATGG - Exonic
1138635258 16:58333183-58333205 ATCAGCCCACAGGAGAGCCTTGG + Intronic
1138778907 16:59758714-59758736 ATCTTACCCTAGGAGAGTCATGG - Intergenic
1140827092 16:78716671-78716693 ATCACACCCAAGGAGAATCATGG + Intronic
1141151792 16:81569435-81569457 ATGTCCCTCTGGGAGAGCCAGGG - Intronic
1142207392 16:88790643-88790665 ATCACCCCTTAGAAGAACCCAGG - Intergenic
1142264272 16:89056636-89056658 GTCAGCCCCTAGGTGAGCCCTGG + Intergenic
1145810771 17:27762787-27762809 ACCACACCCGAGGTGAGCCAGGG - Exonic
1146299540 17:31677485-31677507 AGCAGCCGCTAGGAGAGTCAGGG - Intergenic
1151480882 17:74369498-74369520 AACAACCACTTGGAGAGCCAAGG + Exonic
1152095390 17:78269156-78269178 CTCACCCACTCGGAGAGCTACGG - Intergenic
1152392908 17:80013356-80013378 AGCACCACCCAGGTGAGCCAGGG - Exonic
1152451729 17:80385836-80385858 CTCAGCCCCTAGTAGAGACAGGG + Intronic
1154314032 18:13289918-13289940 AGCAGCCTCTAGGAGAACCATGG + Intronic
1155251901 18:23960764-23960786 ATCCCCCCCTCTTAGAGCCAAGG - Intergenic
1160455616 18:78996961-78996983 ATCACCCCCTAGGAGAGCCATGG - Exonic
1160802681 19:977517-977539 TTCACCTCCTAGGCGAGCCCAGG + Intergenic
1161824395 19:6552347-6552369 AAAACCTCCTGGGAGAGCCAGGG - Intergenic
1164829512 19:31309798-31309820 TTCACCCCCTGGGATGGCCACGG + Intronic
1165831055 19:38730574-38730596 TCCACCTTCTAGGAGAGCCAGGG + Exonic
1166996048 19:46720167-46720189 ATCACCCCCGAGGATGGCCTCGG - Exonic
1167289122 19:48614936-48614958 TTCACCCCCTGGGAGAGCACAGG - Intergenic
926753732 2:16219782-16219804 ACCACCGCCCAGGAGGGCCATGG + Intergenic
940604899 2:155909309-155909331 ATCACCGCCCAGGAGAGAGAGGG + Intergenic
942664401 2:178301795-178301817 AACAGCCCCCAGGAGAGGCAGGG - Intronic
942838397 2:180329332-180329354 ATCACCACCTGGGGCAGCCAAGG + Intergenic
944965132 2:204922734-204922756 ATCACCCCCAAGGGGAACCAAGG + Intronic
945144705 2:206725619-206725641 TTCACCCCTTATGAGAGACATGG + Intergenic
945235078 2:207625641-207625663 CTCTCCCGCTAGGAGAGCCCAGG - Intronic
946618643 2:221536630-221536652 ATAACCCCCTTTGAGAGACAAGG - Intronic
948616515 2:239202687-239202709 ATCACCGTCCAGGAGAGACAAGG + Intronic
1168892609 20:1304806-1304828 GTCACCGCCAAGGAGAGGCAGGG - Intronic
1168957094 20:1841796-1841818 ATGATCCCCTTGGAGAGACAGGG - Intergenic
1175958148 20:62621877-62621899 CTCATCCCCGAGGAGTGCCAGGG - Intergenic
1178484841 21:33012510-33012532 ATCACCCCCTTGGAGAGTTCTGG + Intergenic
1178595852 21:33951605-33951627 ATGAGCCCTTAGGACAGCCAGGG + Intergenic
1180611822 22:17103375-17103397 AGCACCCCTTAGGAAGGCCAGGG - Intronic
1180917403 22:19498832-19498854 AAAACCTCCCAGGAGAGCCATGG - Intronic
1181050366 22:20235445-20235467 ATCACCCCCTGGGTGAGAGAGGG - Intergenic
1183222855 22:36528372-36528394 ATCACCTCCCTGGAAAGCCAGGG + Intronic
1184613059 22:45618342-45618364 GCCACTCCCTAGGAGAGCCCTGG + Intergenic
1184918729 22:47590790-47590812 GCCACTCCCTAGGAGAGCCCTGG - Intergenic
949698833 3:6732017-6732039 CTAACCCCATAGGAGAGTCATGG + Intergenic
950376232 3:12574559-12574581 GTCACCTCCTAGGAAAGCAAGGG + Intronic
954119772 3:48490398-48490420 ACCACCACCCAGCAGAGCCATGG + Intronic
956785476 3:72638701-72638723 ATTTCCCCCTAGGAGATCTAAGG - Intergenic
957899048 3:86464158-86464180 ATCACCCACTAGGTGGGCCGTGG + Intergenic
960592422 3:119378737-119378759 CTCACCGCCTTGCAGAGCCAGGG + Intronic
967297142 3:187976052-187976074 ATCACTCCCTAGGAAACCAAGGG - Intergenic
968970038 4:3788994-3789016 ATGAACCCCACGGAGAGCCAAGG + Intergenic
969971906 4:11056454-11056476 GTTACCCCCAAGGGGAGCCAGGG - Intergenic
970889850 4:21030952-21030974 AACACCCTCAAGCAGAGCCATGG - Intronic
982090437 4:151875770-151875792 ATCACCCCATATGACAGACAAGG - Intergenic
982544794 4:156721039-156721061 ATTCACCCCTAGGTGAGCCAAGG + Intergenic
986709845 5:10480681-10480703 AGCATCCCCTGGGAGAGCCTTGG + Intergenic
987075365 5:14377212-14377234 ATAACCCCTTAGGAGAGGAAAGG - Intronic
988551426 5:32204218-32204240 ACCACTCCCTAGGAGAGCCCTGG - Intergenic
989073995 5:37543056-37543078 TTCACCCTCCAGGATAGCCAGGG - Intronic
997379622 5:133426319-133426341 AGCACAGCCCAGGAGAGCCACGG - Intronic
1001891692 5:175344691-175344713 ATCACCTCCCAGGAGACCAAAGG + Intergenic
1003761972 6:9188659-9188681 ATCACTGCCTAGGTGAGCCCCGG - Intergenic
1012873433 6:104697892-104697914 ACCACCCCCTAGTAGAGACAGGG + Intergenic
1015817050 6:137221441-137221463 ATCATTCCCAAGGAGAGCAATGG + Intergenic
1018516349 6:164583997-164584019 AACATCCCCTAAAAGAGCCAAGG - Intergenic
1021527190 7:21601559-21601581 ATCACCCTCTTGGAAAGCTATGG + Exonic
1022570477 7:31448310-31448332 ATCACCCCACAGGACACCCAGGG + Intergenic
1023053632 7:36274280-36274302 CTCAGCCCTAAGGAGAGCCAGGG + Intronic
1028826850 7:95283430-95283452 ATCTCCCACTTGGAGGGCCAGGG - Intronic
1031151387 7:118058205-118058227 ATCAGTTCCTAGGAGAGCAAAGG - Intergenic
1039976241 8:42367697-42367719 ATCAAACCTTAGGAAAGCCATGG + Intronic
1041551303 8:59104373-59104395 GACTCCCCCTCGGAGAGCCAAGG + Intronic
1047930652 8:129725464-129725486 ATCACCCCCCTCCAGAGCCAGGG + Intergenic
1049787366 8:144457440-144457462 ATCACCACCTTGGGCAGCCATGG + Intronic
1051710755 9:19928084-19928106 ACCAACCCCTAGGAGACCCCAGG - Intergenic
1055621192 9:78126526-78126548 ATCTCCCCAGAGGAGAGCCTTGG - Intergenic
1056577811 9:87869319-87869341 ATGCCCCCCAGGGAGAGCCATGG + Intergenic
1058757612 9:108097726-108097748 ATCCCTCCCTAGGAGAAGCATGG - Intergenic
1059336482 9:113572358-113572380 ATCACCCCCAAGCAGAGATAGGG + Intronic
1060754314 9:126201351-126201373 ATGACCCACTAGAAGAGCTAAGG + Intergenic
1061090666 9:128424261-128424283 ATCACCCCCCAGGTGAGGCCGGG + Exonic
1061424665 9:130491492-130491514 ATCACCAGCCAGGAGAGCCTGGG - Intronic
1062050743 9:134445410-134445432 ATCAGCCCTTAGGACAGTCAAGG + Intergenic
1062274331 9:135723662-135723684 GACACCCACCAGGAGAGCCAGGG - Intronic
1189587751 X:42478014-42478036 ATCGCCCCTTAGGAGAGCAGGGG - Intergenic
1192173741 X:68873283-68873305 CTGACCCACTAGGAGAGCCAAGG - Intergenic
1192795634 X:74422218-74422240 CCCGCACCCTAGGAGAGCCATGG - Intronic
1194818252 X:98471884-98471906 ATCACTGACTAGGAGAACCAGGG + Intergenic
1198518823 X:137432353-137432375 AGCACACCCCAGGAGAGCTAGGG + Intergenic