ID: 1160457109

View in Genome Browser
Species Human (GRCh38)
Location 18:79009108-79009130
Sequence GACACAGGCCAGGGAGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160457109_1160457119 26 Left 1160457109 18:79009108-79009130 CCCGCCACTCCCTGGCCTGTGTC No data
Right 1160457119 18:79009157-79009179 CCTCATCAGAGGAGCCCGCGTGG No data
1160457109_1160457116 15 Left 1160457109 18:79009108-79009130 CCCGCCACTCCCTGGCCTGTGTC No data
Right 1160457116 18:79009146-79009168 TATTCCATCTTCCTCATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160457109 Original CRISPR GACACAGGCCAGGGAGTGGC GGG (reversed) Intergenic