ID: 1160457111

View in Genome Browser
Species Human (GRCh38)
Location 18:79009112-79009134
Sequence TGCAGACACAGGCCAGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160457111_1160457119 22 Left 1160457111 18:79009112-79009134 CCACTCCCTGGCCTGTGTCTGCA No data
Right 1160457119 18:79009157-79009179 CCTCATCAGAGGAGCCCGCGTGG No data
1160457111_1160457116 11 Left 1160457111 18:79009112-79009134 CCACTCCCTGGCCTGTGTCTGCA No data
Right 1160457116 18:79009146-79009168 TATTCCATCTTCCTCATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160457111 Original CRISPR TGCAGACACAGGCCAGGGAG TGG (reversed) Intergenic
No off target data available for this crispr