ID: 1160457113

View in Genome Browser
Species Human (GRCh38)
Location 18:79009118-79009140
Sequence ACAGTGTGCAGACACAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160457113_1160457119 16 Left 1160457113 18:79009118-79009140 CCTGGCCTGTGTCTGCACACTGT No data
Right 1160457119 18:79009157-79009179 CCTCATCAGAGGAGCCCGCGTGG No data
1160457113_1160457121 27 Left 1160457113 18:79009118-79009140 CCTGGCCTGTGTCTGCACACTGT No data
Right 1160457121 18:79009168-79009190 GAGCCCGCGTGGCCCACTGCGGG No data
1160457113_1160457120 26 Left 1160457113 18:79009118-79009140 CCTGGCCTGTGTCTGCACACTGT No data
Right 1160457120 18:79009167-79009189 GGAGCCCGCGTGGCCCACTGCGG No data
1160457113_1160457116 5 Left 1160457113 18:79009118-79009140 CCTGGCCTGTGTCTGCACACTGT No data
Right 1160457116 18:79009146-79009168 TATTCCATCTTCCTCATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160457113 Original CRISPR ACAGTGTGCAGACACAGGCC AGG (reversed) Intergenic
No off target data available for this crispr