ID: 1160457115

View in Genome Browser
Species Human (GRCh38)
Location 18:79009141-79009163
Sequence GATGAGGAAGATGGAATACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160457115_1160457121 4 Left 1160457115 18:79009141-79009163 CCATGTATTCCATCTTCCTCATC No data
Right 1160457121 18:79009168-79009190 GAGCCCGCGTGGCCCACTGCGGG No data
1160457115_1160457127 30 Left 1160457115 18:79009141-79009163 CCATGTATTCCATCTTCCTCATC No data
Right 1160457127 18:79009194-79009216 CTCACCTTGCCAACCGCTGTGGG No data
1160457115_1160457119 -7 Left 1160457115 18:79009141-79009163 CCATGTATTCCATCTTCCTCATC No data
Right 1160457119 18:79009157-79009179 CCTCATCAGAGGAGCCCGCGTGG No data
1160457115_1160457120 3 Left 1160457115 18:79009141-79009163 CCATGTATTCCATCTTCCTCATC No data
Right 1160457120 18:79009167-79009189 GGAGCCCGCGTGGCCCACTGCGG No data
1160457115_1160457126 29 Left 1160457115 18:79009141-79009163 CCATGTATTCCATCTTCCTCATC No data
Right 1160457126 18:79009193-79009215 ACTCACCTTGCCAACCGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160457115 Original CRISPR GATGAGGAAGATGGAATACA TGG (reversed) Intergenic
No off target data available for this crispr