ID: 1160457116

View in Genome Browser
Species Human (GRCh38)
Location 18:79009146-79009168
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160457114_1160457116 0 Left 1160457114 18:79009123-79009145 CCTGTGTCTGCACACTGTCCATG No data
Right 1160457116 18:79009146-79009168 TATTCCATCTTCCTCATCAGAGG No data
1160457110_1160457116 14 Left 1160457110 18:79009109-79009131 CCGCCACTCCCTGGCCTGTGTCT No data
Right 1160457116 18:79009146-79009168 TATTCCATCTTCCTCATCAGAGG No data
1160457111_1160457116 11 Left 1160457111 18:79009112-79009134 CCACTCCCTGGCCTGTGTCTGCA No data
Right 1160457116 18:79009146-79009168 TATTCCATCTTCCTCATCAGAGG No data
1160457113_1160457116 5 Left 1160457113 18:79009118-79009140 CCTGGCCTGTGTCTGCACACTGT No data
Right 1160457116 18:79009146-79009168 TATTCCATCTTCCTCATCAGAGG No data
1160457112_1160457116 6 Left 1160457112 18:79009117-79009139 CCCTGGCCTGTGTCTGCACACTG No data
Right 1160457116 18:79009146-79009168 TATTCCATCTTCCTCATCAGAGG No data
1160457109_1160457116 15 Left 1160457109 18:79009108-79009130 CCCGCCACTCCCTGGCCTGTGTC No data
Right 1160457116 18:79009146-79009168 TATTCCATCTTCCTCATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160457116 Original CRISPR TATTCCATCTTCCTCATCAG AGG Intergenic