ID: 1160457117

View in Genome Browser
Species Human (GRCh38)
Location 18:79009150-79009172
Sequence GGCTCCTCTGATGAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160457117_1160457127 21 Left 1160457117 18:79009150-79009172 CCATCTTCCTCATCAGAGGAGCC No data
Right 1160457127 18:79009194-79009216 CTCACCTTGCCAACCGCTGTGGG No data
1160457117_1160457121 -5 Left 1160457117 18:79009150-79009172 CCATCTTCCTCATCAGAGGAGCC No data
Right 1160457121 18:79009168-79009190 GAGCCCGCGTGGCCCACTGCGGG No data
1160457117_1160457129 26 Left 1160457117 18:79009150-79009172 CCATCTTCCTCATCAGAGGAGCC No data
Right 1160457129 18:79009199-79009221 CTTGCCAACCGCTGTGGGCCAGG No data
1160457117_1160457120 -6 Left 1160457117 18:79009150-79009172 CCATCTTCCTCATCAGAGGAGCC No data
Right 1160457120 18:79009167-79009189 GGAGCCCGCGTGGCCCACTGCGG No data
1160457117_1160457130 27 Left 1160457117 18:79009150-79009172 CCATCTTCCTCATCAGAGGAGCC No data
Right 1160457130 18:79009200-79009222 TTGCCAACCGCTGTGGGCCAGGG No data
1160457117_1160457126 20 Left 1160457117 18:79009150-79009172 CCATCTTCCTCATCAGAGGAGCC No data
Right 1160457126 18:79009193-79009215 ACTCACCTTGCCAACCGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160457117 Original CRISPR GGCTCCTCTGATGAGGAAGA TGG (reversed) Intergenic