ID: 1160457121

View in Genome Browser
Species Human (GRCh38)
Location 18:79009168-79009190
Sequence GAGCCCGCGTGGCCCACTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160457117_1160457121 -5 Left 1160457117 18:79009150-79009172 CCATCTTCCTCATCAGAGGAGCC No data
Right 1160457121 18:79009168-79009190 GAGCCCGCGTGGCCCACTGCGGG No data
1160457112_1160457121 28 Left 1160457112 18:79009117-79009139 CCCTGGCCTGTGTCTGCACACTG No data
Right 1160457121 18:79009168-79009190 GAGCCCGCGTGGCCCACTGCGGG No data
1160457113_1160457121 27 Left 1160457113 18:79009118-79009140 CCTGGCCTGTGTCTGCACACTGT No data
Right 1160457121 18:79009168-79009190 GAGCCCGCGTGGCCCACTGCGGG No data
1160457115_1160457121 4 Left 1160457115 18:79009141-79009163 CCATGTATTCCATCTTCCTCATC No data
Right 1160457121 18:79009168-79009190 GAGCCCGCGTGGCCCACTGCGGG No data
1160457114_1160457121 22 Left 1160457114 18:79009123-79009145 CCTGTGTCTGCACACTGTCCATG No data
Right 1160457121 18:79009168-79009190 GAGCCCGCGTGGCCCACTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160457121 Original CRISPR GAGCCCGCGTGGCCCACTGC GGG Intergenic