ID: 1160460210

View in Genome Browser
Species Human (GRCh38)
Location 18:79033482-79033504
Sequence TTGTGGAAGGCTCTGAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460210_1160460214 4 Left 1160460210 18:79033482-79033504 CCATATCTCAGAGCCTTCCACAA No data
Right 1160460214 18:79033509-79033531 CACCCTCCACCCAGGCATCCTGG No data
1160460210_1160460213 -4 Left 1160460210 18:79033482-79033504 CCATATCTCAGAGCCTTCCACAA No data
Right 1160460213 18:79033501-79033523 ACAACTCTCACCCTCCACCCAGG No data
1160460210_1160460221 25 Left 1160460210 18:79033482-79033504 CCATATCTCAGAGCCTTCCACAA No data
Right 1160460221 18:79033530-79033552 GGTTCTAGATTCAGTCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460210 Original CRISPR TTGTGGAAGGCTCTGAGATA TGG (reversed) Intergenic
No off target data available for this crispr