ID: 1160460340

View in Genome Browser
Species Human (GRCh38)
Location 18:79034222-79034244
Sequence TCGTGGAAGGCTCTGAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460340_1160460351 25 Left 1160460340 18:79034222-79034244 CCATGTCTCAGAGCCTTCCACGA No data
Right 1160460351 18:79034270-79034292 GGTTCTAGATTCAGTCCTCATGG No data
1160460340_1160460344 4 Left 1160460340 18:79034222-79034244 CCATGTCTCAGAGCCTTCCACGA No data
Right 1160460344 18:79034249-79034271 CACCCTCCACCCAGGCATCCTGG No data
1160460340_1160460343 -4 Left 1160460340 18:79034222-79034244 CCATGTCTCAGAGCCTTCCACGA No data
Right 1160460343 18:79034241-79034263 ACGACTCTCACCCTCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460340 Original CRISPR TCGTGGAAGGCTCTGAGACA TGG (reversed) Intergenic
No off target data available for this crispr