ID: 1160460366

View in Genome Browser
Species Human (GRCh38)
Location 18:79034370-79034392
Sequence TCGTGGAAGGCTCTGAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460366_1160460370 4 Left 1160460366 18:79034370-79034392 CCATGTCTCAGAGCCTTCCACGA No data
Right 1160460370 18:79034397-79034419 CACCCTCCACCCAGGCATCCTGG No data
1160460366_1160460377 25 Left 1160460366 18:79034370-79034392 CCATGTCTCAGAGCCTTCCACGA No data
Right 1160460377 18:79034418-79034440 GGTTCTAGATTCAGTCCTCATGG No data
1160460366_1160460369 -4 Left 1160460366 18:79034370-79034392 CCATGTCTCAGAGCCTTCCACGA No data
Right 1160460369 18:79034389-79034411 ACGACTCTCACCCTCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460366 Original CRISPR TCGTGGAAGGCTCTGAGACA TGG (reversed) Intergenic
No off target data available for this crispr