ID: 1160460379

View in Genome Browser
Species Human (GRCh38)
Location 18:79034444-79034466
Sequence TTGTGGAAGGCTCTGAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460379_1160460390 25 Left 1160460379 18:79034444-79034466 CCATATCTCAGAGCCTTCCACAA No data
Right 1160460390 18:79034492-79034514 GGTTCTAGATTCAGTCCTCATGG No data
1160460379_1160460382 -4 Left 1160460379 18:79034444-79034466 CCATATCTCAGAGCCTTCCACAA No data
Right 1160460382 18:79034463-79034485 ACAACTCTCACCCTCCACCCAGG No data
1160460379_1160460383 4 Left 1160460379 18:79034444-79034466 CCATATCTCAGAGCCTTCCACAA No data
Right 1160460383 18:79034471-79034493 CACCCTCCACCCAGGCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460379 Original CRISPR TTGTGGAAGGCTCTGAGATA TGG (reversed) Intergenic
No off target data available for this crispr