ID: 1160460431

View in Genome Browser
Species Human (GRCh38)
Location 18:79034740-79034762
Sequence TTGTGGAAGGCTCTGAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460431_1160460442 25 Left 1160460431 18:79034740-79034762 CCATATCTCAGAGCCTTCCACAA No data
Right 1160460442 18:79034788-79034810 GGTTCTAGATTCAGTCCTCATGG No data
1160460431_1160460435 4 Left 1160460431 18:79034740-79034762 CCATATCTCAGAGCCTTCCACAA No data
Right 1160460435 18:79034767-79034789 CACCCTCCACCCAGGCATCCTGG No data
1160460431_1160460434 -4 Left 1160460431 18:79034740-79034762 CCATATCTCAGAGCCTTCCACAA No data
Right 1160460434 18:79034759-79034781 ACAACTCTCACCCTCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460431 Original CRISPR TTGTGGAAGGCTCTGAGATA TGG (reversed) Intergenic
No off target data available for this crispr