ID: 1160460470

View in Genome Browser
Species Human (GRCh38)
Location 18:79034962-79034984
Sequence TCGTGGAAGGCTCTGAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460470_1160460473 -4 Left 1160460470 18:79034962-79034984 CCATGTCTCAGAGCCTTCCACGA No data
Right 1160460473 18:79034981-79035003 ACGACTCTCACCCTCCACCCAGG No data
1160460470_1160460474 4 Left 1160460470 18:79034962-79034984 CCATGTCTCAGAGCCTTCCACGA No data
Right 1160460474 18:79034989-79035011 CACCCTCCACCCAGGCATCCTGG No data
1160460470_1160460481 25 Left 1160460470 18:79034962-79034984 CCATGTCTCAGAGCCTTCCACGA No data
Right 1160460481 18:79035010-79035032 GGTTCTAGATTCAGTCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460470 Original CRISPR TCGTGGAAGGCTCTGAGACA TGG (reversed) Intergenic
No off target data available for this crispr