ID: 1160460496

View in Genome Browser
Species Human (GRCh38)
Location 18:79035110-79035132
Sequence TCATGGAAGGCTCTGAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460496_1160460507 25 Left 1160460496 18:79035110-79035132 CCATATCTCAGAGCCTTCCATGA No data
Right 1160460507 18:79035158-79035180 GGTTCTAGATTCAGTCCTCAAGG No data
1160460496_1160460500 4 Left 1160460496 18:79035110-79035132 CCATATCTCAGAGCCTTCCATGA No data
Right 1160460500 18:79035137-79035159 CACCCTCCACCCAGGCATCCTGG No data
1160460496_1160460499 -4 Left 1160460496 18:79035110-79035132 CCATATCTCAGAGCCTTCCATGA No data
Right 1160460499 18:79035129-79035151 ATGACTCTCACCCTCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460496 Original CRISPR TCATGGAAGGCTCTGAGATA TGG (reversed) Intergenic
No off target data available for this crispr