ID: 1160460586

View in Genome Browser
Species Human (GRCh38)
Location 18:79035628-79035650
Sequence TCGTGGAAGGCTCTGAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460586_1160460589 -4 Left 1160460586 18:79035628-79035650 CCATGTCTCAGAGCCTTCCACGA No data
Right 1160460589 18:79035647-79035669 ACGACTCTCACCCTCCACCCAGG No data
1160460586_1160460597 25 Left 1160460586 18:79035628-79035650 CCATGTCTCAGAGCCTTCCACGA No data
Right 1160460597 18:79035676-79035698 GGTTCTAGATTCAGTCCTCATGG No data
1160460586_1160460590 4 Left 1160460586 18:79035628-79035650 CCATGTCTCAGAGCCTTCCACGA No data
Right 1160460590 18:79035655-79035677 CACCCTCCACCCAGGCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460586 Original CRISPR TCGTGGAAGGCTCTGAGACA TGG (reversed) Intergenic
No off target data available for this crispr