ID: 1160460638

View in Genome Browser
Species Human (GRCh38)
Location 18:79035924-79035946
Sequence TCATGGAAGGCTCTGAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460638_1160460649 25 Left 1160460638 18:79035924-79035946 CCATATCTCAGAGCCTTCCATGA No data
Right 1160460649 18:79035972-79035994 GGTTCTAGATTCAGTCCTCATGG No data
1160460638_1160460641 -4 Left 1160460638 18:79035924-79035946 CCATATCTCAGAGCCTTCCATGA No data
Right 1160460641 18:79035943-79035965 ATGACTCTCACCCTCCACCCAGG No data
1160460638_1160460642 4 Left 1160460638 18:79035924-79035946 CCATATCTCAGAGCCTTCCATGA No data
Right 1160460642 18:79035951-79035973 CACCCTCCACCCAGGCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460638 Original CRISPR TCATGGAAGGCTCTGAGATA TGG (reversed) Intergenic
No off target data available for this crispr