ID: 1160460664

View in Genome Browser
Species Human (GRCh38)
Location 18:79036072-79036094
Sequence CTGTGAAAGGCTCTGAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460664_1160460666 -4 Left 1160460664 18:79036072-79036094 CCATATCTCAGAGCCTTTCACAG No data
Right 1160460666 18:79036091-79036113 ACAGCTCTCACCCTCCACCCAGG No data
1160460664_1160460667 4 Left 1160460664 18:79036072-79036094 CCATATCTCAGAGCCTTTCACAG No data
Right 1160460667 18:79036099-79036121 CACCCTCCACCCAGGCATCCTGG No data
1160460664_1160460674 25 Left 1160460664 18:79036072-79036094 CCATATCTCAGAGCCTTTCACAG No data
Right 1160460674 18:79036120-79036142 GGTTCTAGATTCAGTCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460664 Original CRISPR CTGTGAAAGGCTCTGAGATA TGG (reversed) Intergenic
No off target data available for this crispr