ID: 1160460754

View in Genome Browser
Species Human (GRCh38)
Location 18:79036590-79036612
Sequence TCGTGGAAGGCTCTGAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460754_1160460758 4 Left 1160460754 18:79036590-79036612 CCATATCTCAGAGCCTTCCACGA No data
Right 1160460758 18:79036617-79036639 CACCCTCCACCCAGGCATCCTGG No data
1160460754_1160460757 -4 Left 1160460754 18:79036590-79036612 CCATATCTCAGAGCCTTCCACGA No data
Right 1160460757 18:79036609-79036631 ACGACTCTCACCCTCCACCCAGG No data
1160460754_1160460765 25 Left 1160460754 18:79036590-79036612 CCATATCTCAGAGCCTTCCACGA No data
Right 1160460765 18:79036638-79036660 GGTTCTAGATTCAGTCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460754 Original CRISPR TCGTGGAAGGCTCTGAGATA TGG (reversed) Intergenic
No off target data available for this crispr