ID: 1160460780

View in Genome Browser
Species Human (GRCh38)
Location 18:79036738-79036760
Sequence TTGTGGAAGGCTCTGAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460780_1160460791 25 Left 1160460780 18:79036738-79036760 CCATATCTCAGAGCCTTCCACAA No data
Right 1160460791 18:79036786-79036808 GGTTCTAGATTCAGTCCTCATGG No data
1160460780_1160460784 4 Left 1160460780 18:79036738-79036760 CCATATCTCAGAGCCTTCCACAA No data
Right 1160460784 18:79036765-79036787 CACCCTCCACCCAGGCATCCTGG No data
1160460780_1160460783 -4 Left 1160460780 18:79036738-79036760 CCATATCTCAGAGCCTTCCACAA No data
Right 1160460783 18:79036757-79036779 ACAACTCTCACCCTCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460780 Original CRISPR TTGTGGAAGGCTCTGAGATA TGG (reversed) Intergenic
No off target data available for this crispr