ID: 1160460806

View in Genome Browser
Species Human (GRCh38)
Location 18:79036886-79036908
Sequence TCGTGGAAGGCTCTGAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460806_1160460817 25 Left 1160460806 18:79036886-79036908 CCATATCTCAGAGCCTTCCACGA No data
Right 1160460817 18:79036934-79036956 GGTTCTAGATTCAGTCCTCATGG No data
1160460806_1160460809 -4 Left 1160460806 18:79036886-79036908 CCATATCTCAGAGCCTTCCACGA No data
Right 1160460809 18:79036905-79036927 ACGACTCTCACCCTCCACCCAGG No data
1160460806_1160460810 4 Left 1160460806 18:79036886-79036908 CCATATCTCAGAGCCTTCCACGA No data
Right 1160460810 18:79036913-79036935 CACCCTCCACCCAGGCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460806 Original CRISPR TCGTGGAAGGCTCTGAGATA TGG (reversed) Intergenic
No off target data available for this crispr