ID: 1160460819

View in Genome Browser
Species Human (GRCh38)
Location 18:79036960-79036982
Sequence TTGTGGAAGGCTCTGAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460819_1160460830 25 Left 1160460819 18:79036960-79036982 CCATATCTCAGAGCCTTCCACAA No data
Right 1160460830 18:79037008-79037030 GGTTCTAGATTCAGTCCTCATGG No data
1160460819_1160460822 -4 Left 1160460819 18:79036960-79036982 CCATATCTCAGAGCCTTCCACAA No data
Right 1160460822 18:79036979-79037001 ACAACTCTCACCCTCCACCCAGG No data
1160460819_1160460823 4 Left 1160460819 18:79036960-79036982 CCATATCTCAGAGCCTTCCACAA No data
Right 1160460823 18:79036987-79037009 CACCCTCCACCCAGGCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460819 Original CRISPR TTGTGGAAGGCTCTGAGATA TGG (reversed) Intergenic
No off target data available for this crispr