ID: 1160460832

View in Genome Browser
Species Human (GRCh38)
Location 18:79037034-79037056
Sequence CTGTGAAAGGCTCTGAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460832_1160460834 -4 Left 1160460832 18:79037034-79037056 CCATATCTCAGAGCCTTTCACAG No data
Right 1160460834 18:79037053-79037075 ACAGCTCTCACTCTCCACCCAGG No data
1160460832_1160460835 4 Left 1160460832 18:79037034-79037056 CCATATCTCAGAGCCTTTCACAG No data
Right 1160460835 18:79037061-79037083 CACTCTCCACCCAGGCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460832 Original CRISPR CTGTGAAAGGCTCTGAGATA TGG (reversed) Intergenic
No off target data available for this crispr