ID: 1160460912

View in Genome Browser
Species Human (GRCh38)
Location 18:79037412-79037434
Sequence CCTTGGAAGGCTCTGAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460912_1160460917 -2 Left 1160460912 18:79037412-79037434 CCATATCTCAGAGCCTTCCAAGG No data
Right 1160460917 18:79037433-79037455 GGGACTGCCACCCTCCACCCAGG No data
1160460912_1160460925 27 Left 1160460912 18:79037412-79037434 CCATATCTCAGAGCCTTCCAAGG No data
Right 1160460925 18:79037462-79037484 GGTTCCAGAAGCATTCCTCATGG No data
1160460912_1160460919 6 Left 1160460912 18:79037412-79037434 CCATATCTCAGAGCCTTCCAAGG No data
Right 1160460919 18:79037441-79037463 CACCCTCCACCCAGGCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460912 Original CRISPR CCTTGGAAGGCTCTGAGATA TGG (reversed) Intergenic
No off target data available for this crispr