ID: 1160460930

View in Genome Browser
Species Human (GRCh38)
Location 18:79037488-79037510
Sequence CCCTGGAAGGCTCTGAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460930_1160460935 -2 Left 1160460930 18:79037488-79037510 CCATATCTCAGAGCCTTCCAGGG No data
Right 1160460935 18:79037509-79037531 GGGACTGTCAGTTTCCACCCAGG No data
1160460930_1160460939 15 Left 1160460930 18:79037488-79037510 CCATATCTCAGAGCCTTCCAGGG No data
Right 1160460939 18:79037526-79037548 CCCAGGCATCCTGGCTCCAGAGG No data
1160460930_1160460936 6 Left 1160460930 18:79037488-79037510 CCATATCTCAGAGCCTTCCAGGG No data
Right 1160460936 18:79037517-79037539 CAGTTTCCACCCAGGCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460930 Original CRISPR CCCTGGAAGGCTCTGAGATA TGG (reversed) Intergenic
No off target data available for this crispr