ID: 1160460948

View in Genome Browser
Species Human (GRCh38)
Location 18:79037561-79037583
Sequence CTGGAAGGCCTGAGACATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460948_1160460955 -1 Left 1160460948 18:79037561-79037583 CCACCATGTCTCAGGCCTTCCAG No data
Right 1160460955 18:79037583-79037605 GGGGATGTCACCCTCCACCCAGG No data
1160460948_1160460956 7 Left 1160460948 18:79037561-79037583 CCACCATGTCTCAGGCCTTCCAG No data
Right 1160460956 18:79037591-79037613 CACCCTCCACCCAGGCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460948 Original CRISPR CTGGAAGGCCTGAGACATGG TGG (reversed) Intergenic
No off target data available for this crispr