ID: 1160460968

View in Genome Browser
Species Human (GRCh38)
Location 18:79037638-79037660
Sequence TCCTGGAAGGCTCTGAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160460968_1160460971 -2 Left 1160460968 18:79037638-79037660 CCATATCTCAGAGCCTTCCAGGA No data
Right 1160460971 18:79037659-79037681 GAGACTGTCAGTTTCCACCCAGG No data
1160460968_1160460972 6 Left 1160460968 18:79037638-79037660 CCATATCTCAGAGCCTTCCAGGA No data
Right 1160460972 18:79037667-79037689 CAGTTTCCACCCAGGCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160460968 Original CRISPR TCCTGGAAGGCTCTGAGATA TGG (reversed) Intergenic
No off target data available for this crispr