ID: 1160461508

View in Genome Browser
Species Human (GRCh38)
Location 18:79042194-79042216
Sequence CCGTCTAAACAGAAGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160461508_1160461516 7 Left 1160461508 18:79042194-79042216 CCTTGCACCTTCTGTTTAGACGG No data
Right 1160461516 18:79042224-79042246 AATCTGTAGACAATATCGAAGGG No data
1160461508_1160461520 29 Left 1160461508 18:79042194-79042216 CCTTGCACCTTCTGTTTAGACGG No data
Right 1160461520 18:79042246-79042268 GCCACAAAGGTGGACAAGGAAGG No data
1160461508_1160461517 16 Left 1160461508 18:79042194-79042216 CCTTGCACCTTCTGTTTAGACGG No data
Right 1160461517 18:79042233-79042255 ACAATATCGAAGGGCCACAAAGG No data
1160461508_1160461515 6 Left 1160461508 18:79042194-79042216 CCTTGCACCTTCTGTTTAGACGG No data
Right 1160461515 18:79042223-79042245 CAATCTGTAGACAATATCGAAGG No data
1160461508_1160461519 25 Left 1160461508 18:79042194-79042216 CCTTGCACCTTCTGTTTAGACGG No data
Right 1160461519 18:79042242-79042264 AAGGGCCACAAAGGTGGACAAGG No data
1160461508_1160461522 30 Left 1160461508 18:79042194-79042216 CCTTGCACCTTCTGTTTAGACGG No data
Right 1160461522 18:79042247-79042269 CCACAAAGGTGGACAAGGAAGGG No data
1160461508_1160461518 19 Left 1160461508 18:79042194-79042216 CCTTGCACCTTCTGTTTAGACGG No data
Right 1160461518 18:79042236-79042258 ATATCGAAGGGCCACAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160461508 Original CRISPR CCGTCTAAACAGAAGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr